Incidental Mutation 'RF013:Lmna'
ID 603316
Institutional Source Beutler Lab
Gene Symbol Lmna
Ensembl Gene ENSMUSG00000028063
Gene Name lamin A
Synonyms Dhe, lamin A/C
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 88480147-88509956 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88484054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000029699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029699] [ENSMUST00000036252] [ENSMUST00000120377]
AlphaFold P48678
PDB Structure Solution structure of immunoglobulin like domain of mouse nuclear lamin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000029699
AA Change: V494A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029699
Gene: ENSMUSG00000028063
AA Change: V494A

DomainStartEndE-ValueType
Filament 30 386 4.38e-45 SMART
low complexity region 395 414 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
Pfam:LTD 433 544 4e-15 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 600 639 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036252
AA Change: V382A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040265
Gene: ENSMUSG00000028063
AA Change: V382A

DomainStartEndE-ValueType
Pfam:Filament 2 274 5.6e-66 PFAM
low complexity region 283 302 N/A INTRINSIC
Pfam:LTD 317 436 1.2e-22 PFAM
low complexity region 439 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120377
AA Change: V494A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113093
Gene: ENSMUSG00000028063
AA Change: V494A

DomainStartEndE-ValueType
Pfam:Filament 30 386 1.3e-95 PFAM
low complexity region 395 414 N/A INTRINSIC
Pfam:LTD 429 548 1.7e-22 PFAM
low complexity region 551 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the lamin family. Nuclear lamins, intermediate filament-like proteins, are the major components of the nuclear lamina, a protein meshwork associated with the inner nuclear membrane. This meshwork is thought to maintain the integrity of the nuclear envelope, participate in chromatin organization, and regulate gene transcription. Vertebrate lamins consist of two types, A and B. This protein is an A-type and is proposed to be developmentally regulated. In mouse deficiency of this gene is associated with muscular dystrophy. Mouse lines with different mutations in this gene serve as pathophysiological models for several human laminopathies. In humans, mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit retarded postnatal growth, muscular dystrophy, reduced fat stores, micrognathy, abnormal dentition, impaired gonadal development, malformed scapulae, hyperkeratosis, and die by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Lmna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lmna APN 3 88484684 missense probably benign 0.05
IGL00933:Lmna APN 3 88482549 missense possibly damaging 0.73
IGL01347:Lmna APN 3 88484963 missense probably benign 0.42
IGL02881:Lmna APN 3 88502926 missense possibly damaging 0.56
P0029:Lmna UTSW 3 88483917 missense possibly damaging 0.88
R0606:Lmna UTSW 3 88482578 missense probably damaging 1.00
R1547:Lmna UTSW 3 88482351 missense probably benign 0.00
R4751:Lmna UTSW 3 88486533 missense possibly damaging 0.87
R5157:Lmna UTSW 3 88484107 missense probably damaging 1.00
R5857:Lmna UTSW 3 88482531 unclassified probably benign
R6112:Lmna UTSW 3 88486621 nonsense probably null
R6263:Lmna UTSW 3 88502958 missense probably damaging 1.00
R6328:Lmna UTSW 3 88486506 missense probably damaging 1.00
R6604:Lmna UTSW 3 88488282 missense probably damaging 0.97
R7100:Lmna UTSW 3 88484990 missense probably damaging 0.99
R8080:Lmna UTSW 3 88486561 missense probably damaging 0.99
R8841:Lmna UTSW 3 88484613 critical splice donor site probably null
R9347:Lmna UTSW 3 88486241 missense probably damaging 0.98
R9665:Lmna UTSW 3 88482486 missense probably benign 0.18
R9666:Lmna UTSW 3 88482550 frame shift probably null
R9667:Lmna UTSW 3 88482550 frame shift probably null
R9694:Lmna UTSW 3 88482550 frame shift probably null
Z1177:Lmna UTSW 3 88486236 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCAGTGGAGTTGATGAGAGC -3'
(R):5'- CTGAGTGAGATAATCCAAGAGTCG -3'

Sequencing Primer
(F):5'- AGCCCCAGGTGTTCTGC -3'
(R):5'- TCCAAGAGTCGGTTGAACTC -3'
Posted On 2019-12-04