Mutagenetix > Incidental Mutation

Incidental Mutation 'R8261:Cntnap2'

639921

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47095693 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1065 (L1065P)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: L1065P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: L1065P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150737

SMART Domains

Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
EGF	25	61	1e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,110,343	S75C	probably damaging	Het
4933412E24Rik	T	C	15: 60,016,576	E5G	probably benign	Het
5730559C18Rik	T	A	1: 136,225,477	N226Y	probably damaging	Het
Adam23	T	C	1: 63,528,798	V202A	noncoding transcript	Het
Adamtsl1	A	C	4: 86,276,883	E512D	probably damaging	Het
Ahnak	A	T	19: 9,005,453	D1367V	probably damaging	Het
Angpt4	A	T	2: 151,927,164	Q198L	probably benign	Het
Apcdd1	T	A	18: 62,933,903	H29Q	possibly damaging	Het
Cdh16	T	A	8: 104,615,179	K755*	probably null	Het
Cdk6	T	G	5: 3,390,685	F80V	probably benign	Het
Chd1	T	C	17: 17,387,542	S451P	probably benign	Het
Chd6	A	G	2: 160,957,082	L2361P	probably damaging	Het
Chst8	A	G	7: 34,748,154	M13T	possibly damaging	Het
Dctn4	T	C	18: 60,526,271	V14A	possibly damaging	Het
Dicer1	A	T	12: 104,691,606	V1903D	probably damaging	Het
E2f2	A	G	4: 136,184,480		silent	Het
Eif4g3	T	A	4: 138,171,118	S902T	possibly damaging	Het
Emid1	G	T	11: 5,134,353	A152D	probably benign	Het
Fer1l6	T	A	15: 58,560,496	N297K	possibly damaging	Het
Fes	T	C	7: 80,383,154	D281G	probably null	Het
Fry	A	G	5: 150,445,907	Y2282C	probably damaging	Het
Gm10377	C	T	14: 42,794,707		probably null	Het
Gm1527	A	G	3: 28,920,600	T521A	probably damaging	Het
Gm626	T	C	14: 33,502,977	V133A	probably benign	Het
Gpr141	T	A	13: 19,751,843	H254L	probably benign	Het
Gpr160	A	G	3: 30,895,947	E56G	probably benign	Het
Grid2ip	T	G	5: 143,381,940		probably null	Het
Grin2a	A	G	16: 9,663,518	F473S	probably damaging	Het
Igkv1-131	T	C	6: 67,766,118	T94A	probably damaging	Het
Iqgap2	A	G	13: 95,635,570	L1367P	probably damaging	Het
Kdm5d	T	A	Y: 936,929	M856K	probably damaging	Het
Kirrel	T	C	3: 87,088,002		probably benign	Het
Lad1	T	C	1: 135,827,762	S259P	probably damaging	Het
Lalba	A	T	15: 98,482,111	F86Y	possibly damaging	Het
Lrfn5	G	A	12: 61,839,537	C37Y	probably damaging	Het
Man2c1	A	G	9: 57,139,658	T665A	probably benign	Het
Myh11	T	C	16: 14,224,003	I719V		Het
Nbl1	A	T	4: 139,085,521	C34S	probably damaging	Het
Ncapg	T	A	5: 45,687,388	I575N	possibly damaging	Het
Nlgn1	T	C	3: 25,433,652	T840A	possibly damaging	Het
Nrd1	T	C	4: 109,016,679	S231P	possibly damaging	Het
Nrg2	T	C	18: 36,032,375	K395E	probably benign	Het
Nrip1	A	T	16: 76,292,061	N869K	possibly damaging	Het
Olfr1259	A	G	2: 89,943,372	F248L	probably benign	Het
Olfr237-ps1	T	A	6: 43,153,308	M1K	probably null	Het
Olfr285	A	T	15: 98,312,665	M295K	probably benign	Het
Otub2	G	T	12: 103,402,902		probably null	Het
Paxbp1	T	C	16: 91,037,415	D161G	probably benign	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Per2	T	A	1: 91,433,448	Q495L	possibly damaging	Het
Plxna2	T	A	1: 194,749,416	V571E	probably damaging	Het
Prr7	C	A	13: 55,472,922	P248T	possibly damaging	Het
Ptprr	A	T	10: 116,237,264	T464S	possibly damaging	Het
Rapgef2	A	G	3: 79,086,018	V721A	probably benign	Het
Rfx1	A	T	8: 84,092,850	Y625F	probably benign	Het
Rps6kb2	G	T	19: 4,161,196	A110D	possibly damaging	Het
Setdb2	A	T	14: 59,413,692		probably benign	Het
Slc25a31	T	C	3: 40,724,920	I272T	probably damaging	Het
Smpd1	T	C	7: 105,555,313	V133A	probably benign	Het
Sorl1	T	C	9: 42,014,481	D1185G	probably damaging	Het
Spag6	T	A	2: 18,745,490	L449H	probably benign	Het
Sptb	C	A	12: 76,621,262	R687L	probably benign	Het
Sptbn5	A	T	2: 120,047,135	V1012E	noncoding transcript	Het
Tmem192	A	G	8: 64,964,320	I188V	probably benign	Het
Tmem253	G	A	14: 52,019,251	V194M	probably benign	Het
Tph1	A	G	7: 46,653,749		silent	Het
Trak1	A	G	9: 121,451,667	E374G	probably damaging	Het
Trpv1	A	T	11: 73,254,767		probably null	Het
Trub2	T	C	2: 29,777,713	H305R	probably benign	Het
Ttn	A	G	2: 76,917,424	V4427A	probably benign	Het
Vasn	A	G	16: 4,648,296	T36A	probably damaging	Het
Vmn1r8	A	T	6: 57,036,173	I70F	probably benign	Het
Vps13c	A	T	9: 67,954,980	I2960L	probably damaging	Het
Zdhhc4	C	A	5: 143,321,833	M144I	probably benign	Het
Zfp273	T	A	13: 67,825,951	N399K	probably benign	Het
Zfp976	T	A	7: 42,612,701	T572S	unknown	Het
Zmym4	A	G	4: 126,904,567	C756R	probably damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTTTGAAGAAGGCATGTGGC -3'
(R):5'- CACTCAGTTGACAAGCTGTTC -3'

Sequencing Primer
(F):5'- GTGGCTGCGCTATAACTTCCAG -3'
(R):5'- TCAAAGGAGTCAGGTACTTTGCCC -3'

Posted On

2020-07-28