Incidental Mutation 'R9367:Greb1l'
ID 709090
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10522130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 742 (H742L)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: H742L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H742L

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: H633L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: H633L

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4930402H24Rik A T 2: 130,739,460 N678K probably benign Het
4930568D16Rik A T 2: 35,354,927 Y138N probably benign Het
Abca4 T C 3: 122,044,548 M1T probably null Het
Acer3 A G 7: 98,259,414 V104A probably damaging Het
Agpat4 A G 17: 12,216,710 E287G probably benign Het
Akip1 C T 7: 109,708,949 A146V unknown Het
Ank2 T C 3: 126,945,029 N2402S unknown Het
Arhgdig A T 17: 26,199,477 Y177* probably null Het
Arhgef38 T A 3: 133,142,237 T355S unknown Het
Atp8a2 C A 14: 60,012,378 probably null Het
Atp8b4 A G 2: 126,374,510 I672T probably damaging Het
Baat T A 4: 49,503,008 D38V probably damaging Het
Bcl9 T C 3: 97,210,545 S278G probably benign Het
Ccdc150 C T 1: 54,285,601 L350F probably damaging Het
Ceacam20 T G 7: 19,971,608 S175A probably damaging Het
Chd6 A T 2: 161,029,864 I217K possibly damaging Het
Cnppd1 T C 1: 75,140,973 I35V probably benign Het
Col15a1 T C 4: 47,245,603 I118T probably damaging Het
Csmd3 A T 15: 47,704,168 Y1289N Het
Dio2 T C 12: 90,729,813 T134A probably benign Het
Dnah17 A G 11: 118,096,638 V1282A possibly damaging Het
Dnah17 A G 11: 118,121,386 S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 probably null Het
Echdc2 C A 4: 108,178,914 P274Q probably damaging Het
Fam117a T A 11: 95,380,744 C381S probably damaging Het
Fbxl12 A G 9: 20,638,834 F122S probably damaging Het
Gen1 G A 12: 11,241,308 Q892* probably null Het
Gimap4 A G 6: 48,690,812 Y167C probably damaging Het
Gle1 T A 2: 29,949,002 F476L probably damaging Het
Gpr135 A T 12: 72,070,699 V98E possibly damaging Het
Habp2 G T 19: 56,316,349 C392F probably damaging Het
Hapln3 G T 7: 79,121,707 R145S probably damaging Het
Ikbkb A G 8: 22,681,695 C179R probably damaging Het
Kat6a A T 8: 22,910,140 I306L possibly damaging Het
Lmo3 A T 6: 138,365,960 Y140* probably null Het
Lrrc32 T A 7: 98,499,730 N572K probably damaging Het
Lrrn1 T A 6: 107,568,132 M297K probably damaging Het
Magi2 G A 5: 20,561,310 V676I probably damaging Het
Mdga1 T C 17: 29,832,308 *957W probably null Het
Mip G T 10: 128,227,160 G158V probably damaging Het
Mmp14 T C 14: 54,440,503 I527T probably benign Het
Mmp27 G A 9: 7,573,549 G188D probably damaging Het
Mylk4 A T 13: 32,776,253 C17S possibly damaging Het
Naa50 T G 16: 44,157,191 I94R probably damaging Het
Nyap1 A T 5: 137,735,986 Y262N probably damaging Het
Obsl1 A G 1: 75,489,533 V1517A probably benign Het
P4htm T A 9: 108,581,948 M262L probably benign Het
Pappa2 T C 1: 158,956,972 E156G probably benign Het
Pcdhb15 A T 18: 37,474,918 Y401F possibly damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Penk C T 4: 4,134,097 M183I probably benign Het
Pole T C 5: 110,297,089 V437A probably damaging Het
Ppp1r7 T C 1: 93,351,540 I114T probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Pwp2 G A 10: 78,178,993 Q386* probably null Het
Rad17 A T 13: 100,633,212 S280T possibly damaging Het
Rhebl1 C T 15: 98,878,533 E128K possibly damaging Het
Sema3e G T 5: 14,241,070 V615L probably benign Het
Slc22a2 A T 17: 12,605,950 Y233F probably benign Het
Ssu2 A G 6: 112,381,014 S123P probably damaging Het
Stk10 A G 11: 32,588,878 E239G Het
Surf6 G T 2: 26,892,368 Q316K probably damaging Het
Tcerg1 G A 18: 42,552,508 D637N possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnxb C A 17: 34,713,019 F2175L probably damaging Het
Trp53i11 G C 2: 93,198,928 V91L probably benign Het
Tspan9 A G 6: 127,967,139 V66A probably damaging Het
Usp16 C T 16: 87,464,781 T95M probably benign Het
Usp9y A T Y: 1,324,982 F1691Y probably damaging Het
Uty A T Y: 1,099,584 L1204I possibly damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vps54 T C 11: 21,300,234 V552A probably benign Het
Vps8 T C 16: 21,521,918 V804A possibly damaging Het
Zfp869 A C 8: 69,708,407 L33R probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
R8997:Greb1l UTSW 18 10510747 missense probably damaging 1.00
R9015:Greb1l UTSW 18 10541675 missense probably benign 0.00
R9018:Greb1l UTSW 18 10542004 missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10532797 missense probably damaging 1.00
R9074:Greb1l UTSW 18 10558795 missense probably damaging 1.00
R9117:Greb1l UTSW 18 10542422 missense probably benign 0.31
R9189:Greb1l UTSW 18 10499983 missense probably benign
R9332:Greb1l UTSW 18 10532796 missense possibly damaging 0.92
R9497:Greb1l UTSW 18 10458600 missense probably benign 0.00
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGTATTGGTCAACAC -3'
(R):5'- AGTGCCTTTACACCATGACTAAAG -3'

Sequencing Primer
(F):5'- GGTCAACACTGAGCTCTCTC -3'
(R):5'- CACCATGACTAAAGGGTTCCTTAGG -3'
Posted On 2022-04-18