Mutagenetix > Incidental Mutation

Incidental Mutation 'R9367:Greb1l'

709090

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9367 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 10522130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 742 (H742L)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: H742L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H742L

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532
AA Change: H633L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: H633L

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
4930402H24Rik	A	T	2: 130,739,460	N678K	probably benign	Het
4930568D16Rik	A	T	2: 35,354,927	Y138N	probably benign	Het
Abca4	T	C	3: 122,044,548	M1T	probably null	Het
Acer3	A	G	7: 98,259,414	V104A	probably damaging	Het
Agpat4	A	G	17: 12,216,710	E287G	probably benign	Het
Akip1	C	T	7: 109,708,949	A146V	unknown	Het
Ank2	T	C	3: 126,945,029	N2402S	unknown	Het
Arhgdig	A	T	17: 26,199,477	Y177*	probably null	Het
Arhgef38	T	A	3: 133,142,237	T355S	unknown	Het
Atp8a2	C	A	14: 60,012,378		probably null	Het
Atp8b4	A	G	2: 126,374,510	I672T	probably damaging	Het
Baat	T	A	4: 49,503,008	D38V	probably damaging	Het
Bcl9	T	C	3: 97,210,545	S278G	probably benign	Het
Ccdc150	C	T	1: 54,285,601	L350F	probably damaging	Het
Ceacam20	T	G	7: 19,971,608	S175A	probably damaging	Het
Chd6	A	T	2: 161,029,864	I217K	possibly damaging	Het
Cnppd1	T	C	1: 75,140,973	I35V	probably benign	Het
Col15a1	T	C	4: 47,245,603	I118T	probably damaging	Het
Csmd3	A	T	15: 47,704,168	Y1289N		Het
Dio2	T	C	12: 90,729,813	T134A	probably benign	Het
Dnah17	A	G	11: 118,096,638	V1282A	possibly damaging	Het
Dnah17	A	G	11: 118,121,386	S517P	possibly damaging	Het
Dync2h1	C	T	9: 7,125,730		probably null	Het
Echdc2	C	A	4: 108,178,914	P274Q	probably damaging	Het
Fam117a	T	A	11: 95,380,744	C381S	probably damaging	Het
Fbxl12	A	G	9: 20,638,834	F122S	probably damaging	Het
Gen1	G	A	12: 11,241,308	Q892*	probably null	Het
Gimap4	A	G	6: 48,690,812	Y167C	probably damaging	Het
Gle1	T	A	2: 29,949,002	F476L	probably damaging	Het
Gpr135	A	T	12: 72,070,699	V98E	possibly damaging	Het
Habp2	G	T	19: 56,316,349	C392F	probably damaging	Het
Hapln3	G	T	7: 79,121,707	R145S	probably damaging	Het
Ikbkb	A	G	8: 22,681,695	C179R	probably damaging	Het
Kat6a	A	T	8: 22,910,140	I306L	possibly damaging	Het
Lmo3	A	T	6: 138,365,960	Y140*	probably null	Het
Lrrc32	T	A	7: 98,499,730	N572K	probably damaging	Het
Lrrn1	T	A	6: 107,568,132	M297K	probably damaging	Het
Magi2	G	A	5: 20,561,310	V676I	probably damaging	Het
Mdga1	T	C	17: 29,832,308	*957W	probably null	Het
Mip	G	T	10: 128,227,160	G158V	probably damaging	Het
Mmp14	T	C	14: 54,440,503	I527T	probably benign	Het
Mmp27	G	A	9: 7,573,549	G188D	probably damaging	Het
Mylk4	A	T	13: 32,776,253	C17S	possibly damaging	Het
Naa50	T	G	16: 44,157,191	I94R	probably damaging	Het
Nyap1	A	T	5: 137,735,986	Y262N	probably damaging	Het
Obsl1	A	G	1: 75,489,533	V1517A	probably benign	Het
P4htm	T	A	9: 108,581,948	M262L	probably benign	Het
Pappa2	T	C	1: 158,956,972	E156G	probably benign	Het
Pcdhb15	A	T	18: 37,474,918	Y401F	possibly damaging	Het
Pde2a	G	A	7: 101,511,154	R845H	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Penk	C	T	4: 4,134,097	M183I	probably benign	Het
Pole	T	C	5: 110,297,089	V437A	probably damaging	Het
Ppp1r7	T	C	1: 93,351,540	I114T	probably damaging	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Pwp2	G	A	10: 78,178,993	Q386*	probably null	Het
Rad17	A	T	13: 100,633,212	S280T	possibly damaging	Het
Rhebl1	C	T	15: 98,878,533	E128K	possibly damaging	Het
Sema3e	G	T	5: 14,241,070	V615L	probably benign	Het
Slc22a2	A	T	17: 12,605,950	Y233F	probably benign	Het
Ssu2	A	G	6: 112,381,014	S123P	probably damaging	Het
Stk10	A	G	11: 32,588,878	E239G		Het
Surf6	G	T	2: 26,892,368	Q316K	probably damaging	Het
Tcerg1	G	A	18: 42,552,508	D637N	possibly damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tnxb	C	A	17: 34,713,019	F2175L	probably damaging	Het
Trp53i11	G	C	2: 93,198,928	V91L	probably benign	Het
Tspan9	A	G	6: 127,967,139	V66A	probably damaging	Het
Usp16	C	T	16: 87,464,781	T95M	probably benign	Het
Usp9y	A	T	Y: 1,324,982	F1691Y	probably damaging	Het
Uty	A	T	Y: 1,099,584	L1204I	possibly damaging	Het
Vmn1r192	A	T	13: 22,187,630	V140D	possibly damaging	Het
Vps54	T	C	11: 21,300,234	V552A	probably benign	Het
Vps8	T	C	16: 21,521,918	V804A	possibly damaging	Het
Zfp869	A	C	8: 69,708,407	L33R	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCCAGTATTGGTCAACAC -3'
(R):5'- AGTGCCTTTACACCATGACTAAAG -3'

Sequencing Primer
(F):5'- GGTCAACACTGAGCTCTCTC -3'
(R):5'- CACCATGACTAAAGGGTTCCTTAGG -3'

Posted On

2022-04-18