Incidental Mutation 'R9395:Cntnap2'
ID 710782
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 068965-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9395 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 45978244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 300 (R300S)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: R300S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: R300S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh7 A T 3: 137,927,477 (GRCm39) I8F probably damaging Het
Ak1 A G 2: 32,523,708 (GRCm39) D207G probably damaging Het
Arhgef28 TAA TA 13: 98,103,692 (GRCm39) probably null Het
Cacna2d1 T C 5: 16,140,013 (GRCm39) M1T probably null Het
Cgnl1 T C 9: 71,539,954 (GRCm39) M1097V probably benign Het
Chrm2 G A 6: 36,501,196 (GRCm39) G351D possibly damaging Het
Cpa5 T C 6: 30,631,280 (GRCm39) L398P probably damaging Het
Csl T A 10: 99,595,020 (GRCm39) N15I probably damaging Het
Csrp3 A T 7: 48,489,231 (GRCm39) V17D probably damaging Het
Cyb5d1 T C 11: 69,284,531 (GRCm39) N207S probably benign Het
Ecel1 A T 1: 87,082,350 (GRCm39) I121N probably damaging Het
Elapor2 T C 5: 9,477,822 (GRCm39) S407P probably benign Het
Gad2 T C 2: 22,514,879 (GRCm39) L119P probably damaging Het
Gpr139 A T 7: 118,743,811 (GRCm39) M258K probably benign Het
Hhipl1 A G 12: 108,285,009 (GRCm39) Y454C probably damaging Het
Ifitm10 A T 7: 141,924,704 (GRCm39) V45D probably damaging Het
Lpl T A 8: 69,353,952 (GRCm39) I431N probably damaging Het
Myh14 A T 7: 44,274,584 (GRCm39) W1235R possibly damaging Het
Nacc2 A G 2: 25,950,128 (GRCm39) V536A probably damaging Het
Nalf2 C T X: 98,889,097 (GRCm39) R321W probably damaging Het
Neu4 T A 1: 93,950,218 (GRCm39) L59Q probably damaging Het
Obscn T A 11: 58,946,871 (GRCm39) I4088F probably damaging Het
Or8b37 T C 9: 37,959,136 (GRCm39) V206A probably damaging Het
Otof G A 5: 30,532,976 (GRCm39) R1589C probably damaging Het
Pla2g3 C T 11: 3,440,952 (GRCm39) Q306* probably null Het
Pramel12 A G 4: 143,145,605 (GRCm39) E358G probably benign Het
Prl6a1 A T 13: 27,499,400 (GRCm39) H56L possibly damaging Het
Rev3l T C 10: 39,735,219 (GRCm39) probably null Het
Rims2 T A 15: 39,155,664 (GRCm39) F115Y probably damaging Het
Spcs2 T C 7: 99,488,924 (GRCm39) T221A probably benign Het
Stmn1 C T 4: 134,200,146 (GRCm39) A73V probably damaging Het
Syne1 T A 10: 5,261,728 (GRCm39) K2250I probably damaging Het
Tcf7l2 C T 19: 55,920,200 (GRCm39) Q578* probably null Het
Tgtp2 A T 11: 48,950,083 (GRCm39) M163K probably benign Het
Ttn T C 2: 76,542,006 (GRCm39) N33660S probably benign Het
Txndc11 A G 16: 10,902,683 (GRCm39) F655L probably benign Het
Ubtf G A 11: 102,205,026 (GRCm39) T86I probably damaging Het
Vmn2r89 T A 14: 51,693,783 (GRCm39) W378R probably damaging Het
Zic1 T A 9: 91,247,070 (GRCm39) M1L probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAGTGGTCTGTGTAGTTAACA -3'
(R):5'- AGCCCCACCTGACTCTTTTA -3'

Sequencing Primer
(F):5'- GGTCTGTGTAGTTAACAACTCATTTC -3'
(R):5'- GCAGAAGTGGAGGAAACTATAATC -3'
Posted On 2022-04-18