Mutagenetix > Incidental Mutation

Incidental Mutation 'R6189:Cntnap2'

502376

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

044329-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6189 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 47271298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1213 (S1213T)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060839] [ENSMUST00000114641] [ENSMUST00000199100]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000060839

SMART Domains

Protein: ENSMUSP00000056299
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: S1213T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S1213T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199100

SMART Domains

Protein: ENSMUSP00000143528
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	G	17: 48,167,054		probably benign	Het
Abca8a	T	C	11: 110,030,884	D1448G	probably damaging	Het
Actn2	C	T	13: 12,276,440	D693N	probably damaging	Het
Adam3	A	C	8: 24,711,336	I267R	probably benign	Het
Akap2	A	G	4: 57,855,928	E419G	probably benign	Het
Aldh1l2	A	G	10: 83,508,013		probably null	Het
C4bp	T	C	1: 130,636,819	Y376C	probably damaging	Het
Cacna1h	A	G	17: 25,397,844	W101R	probably damaging	Het
Ccdc84	G	A	9: 44,410,321	R328C	probably benign	Het
Ccdc97	T	A	7: 25,716,098	T47S	probably benign	Het
Cnot6l	G	A	5: 96,098,277	T171I	probably benign	Het
Cxcl10	A	T	5: 92,348,113	L55Q	probably benign	Het
Cyp1a1	T	C	9: 57,700,683	V198A	probably damaging	Het
Dclre1b	A	G	3: 103,803,533	V354A	probably damaging	Het
Dmxl1	C	T	18: 49,893,335	H1837Y	probably benign	Het
Dnajc13	G	C	9: 104,213,886	D665E	probably benign	Het
Dnmbp	T	C	19: 43,890,309	T108A	probably benign	Het
Dnmbp	T	A	19: 43,901,511	T606S	probably benign	Het
Dok5	T	A	2: 170,800,851	I23N	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epha5	A	T	5: 84,237,540	F311I	probably damaging	Het
Erbb4	T	A	1: 68,043,916	M1059L	probably benign	Het
Fbxo40	A	G	16: 36,966,164	I681T	probably benign	Het
Flg2	T	A	3: 93,220,074	C2098S	unknown	Het
Gm10471	A	G	5: 26,085,693	I160T	probably benign	Het
Gm11397	A	T	13: 33,404,444	E337D	probably benign	Het
Gpr87	T	A	3: 59,179,229	D285V	probably damaging	Het
Hrh1	T	A	6: 114,479,998	V80D	probably damaging	Het
Hunk	G	A	16: 90,487,881	R351K	probably benign	Het
Ifna12	A	G	4: 88,603,011	W100R	probably damaging	Het
Ift57	G	A	16: 49,763,813	G310S	probably damaging	Het
Igf1r	T	A	7: 68,207,336	Y1015*	probably null	Het
Igkv14-130	T	C	6: 67,791,448	I96T	probably damaging	Het
Il34	C	T	8: 110,742,718	S155N	probably benign	Het
Itga7	T	C	10: 128,950,403	S938P	possibly damaging	Het
Itgam	A	G	7: 128,112,504	M764V	probably benign	Het
Lao1	T	A	4: 118,967,880	M299K	probably benign	Het
Lnpep	A	T	17: 17,566,739	S533T	possibly damaging	Het
Lrp4	T	C	2: 91,475,234	V283A	possibly damaging	Het
Magi3	G	T	3: 104,050,865	H635N	probably damaging	Het
Mecr	A	T	4: 131,865,254		probably null	Het
Mgrn1	T	C	16: 4,910,810		probably null	Het
Micalcl	A	C	7: 112,412,880	N646H	probably damaging	Het
Mymk	C	T	2: 27,067,365	V39I	possibly damaging	Het
Nav3	T	C	10: 109,720,019	S1684G	probably damaging	Het
Ntn5	A	T	7: 45,693,220	D330V	probably benign	Het
Nupl2	G	T	5: 24,175,454	G149V	probably damaging	Het
Nutm2	T	A	13: 50,469,738	V157D	possibly damaging	Het
Obscn	T	C	11: 59,069,934	I3460V	probably benign	Het
Olfr1037	A	T	2: 86,084,913	M288K	possibly damaging	Het
Pcdh15	C	T	10: 74,342,651	A580V	probably null	Het
Pcdhb10	T	A	18: 37,412,403	H177Q	probably damaging	Het
Pitx2	T	C	3: 129,218,469	Y130H	probably damaging	Het
Pmch	G	T	10: 88,091,386		probably null	Het
Pofut2	T	A	10: 77,268,586	I399N	probably damaging	Het
Prr36	C	A	8: 4,214,177		probably benign	Het
Ptprq	C	A	10: 107,517,887	C2256F	probably damaging	Het
Rassf5	G	A	1: 131,244,979	A51V	probably damaging	Het
Retnla	A	G	16: 48,842,895	I54V	probably benign	Het
Rimbp2	A	G	5: 128,803,897	L142P	probably benign	Het
Ripk1	A	G	13: 34,032,501	T564A	probably benign	Het
Robo4	G	A	9: 37,403,533	E228K	probably benign	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Homo
Rusc1	A	T	3: 89,089,012	L132Q	probably damaging	Het
Setd1a	T	C	7: 127,778,283		probably null	Het
Slc38a6	A	T	12: 73,310,196	K122M	probably damaging	Het
Susd5	A	T	9: 114,095,658	D203V	probably damaging	Het
Trip4	G	A	9: 65,879,152	R110*	probably null	Het
Tuba4a	T	A	1: 75,216,874	I95F	probably benign	Het
Ube2q2	T	A	9: 55,162,983	S70T	probably benign	Het
Umodl1	A	G	17: 30,996,282	I1027V	possibly damaging	Het
Unc80	G	A	1: 66,677,471	V2917I	probably benign	Het
Vmn1r70	T	A	7: 10,633,671	C29S	probably benign	Het
Vmn2r94	A	T	17: 18,257,734	D138E	probably benign	Het
Wee2	C	T	6: 40,449,683	H129Y	probably damaging	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp872	A	T	9: 22,197,131	D42V	probably benign	Het
Zic5	T	G	14: 122,464,974	D115A	unknown	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GGATGGGTCTGTCTTCCAACAG -3'
(R):5'- CAGTGGAACAACAGCAAGCTTC -3'

Sequencing Primer
(F):5'- CACAGAGAATGGGCTTGGATTC -3'
(R):5'- CTGTAGTCAACCCATTCTATAGCGG -3'

Posted On

2018-02-27