Mutagenetix > Incidental Mutation

Incidental Mutation 'R0118:Cntnap2'

20919

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

038404-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0118 (G1)

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 45037326 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000207647]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000114641

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000207647

Coding Region Coverage

1x: 98.8%
3x: 97.2%
10x: 89.3%
20x: 67.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	T	C	9: 30,823,040 (GRCm39)	R343G	probably damaging	Het
Asxl2	T	G	12: 3,546,923 (GRCm39)	V569G	probably damaging	Het
Azin2	A	C	4: 128,843,430 (GRCm39)	H85Q	probably damaging	Het
Cacna1a	C	T	8: 85,262,712 (GRCm39)	R324C	probably damaging	Het
Ccr3	C	A	9: 123,829,647 (GRCm39)	Y327*	probably null	Het
Cers2	T	C	3: 95,227,537 (GRCm39)	F55S	probably benign	Het
Cic	C	T	7: 24,985,459 (GRCm39)	S301L	probably damaging	Het
Cpn2	T	C	16: 30,079,186 (GRCm39)	R172G	probably benign	Het
Ctdnep1	T	C	11: 69,879,557 (GRCm39)		probably null	Het
Dennd3	T	A	15: 73,436,925 (GRCm39)	Y1051N	probably damaging	Het
Dmap1	T	G	4: 117,533,680 (GRCm39)	Y196S	probably damaging	Het
Entpd7	G	A	19: 43,692,751 (GRCm39)	W102*	probably null	Het
Frem2	A	T	3: 53,442,664 (GRCm39)	C2624*	probably null	Het
Gdpd3	A	G	7: 126,370,165 (GRCm39)	Y238C	probably damaging	Het
Gjb3	A	G	4: 127,220,451 (GRCm39)	V27A	probably damaging	Het
Kat6b	T	C	14: 21,720,042 (GRCm39)	F1465L	probably damaging	Het
Klra17	A	T	6: 129,808,552 (GRCm39)	M227K	probably benign	Het
Map6	A	G	7: 98,966,824 (GRCm39)	D348G	possibly damaging	Het
Mapkbp1	T	C	2: 119,855,696 (GRCm39)	S1472P	probably benign	Het
Megf6	C	A	4: 154,339,098 (GRCm39)	P545Q	probably damaging	Het
Mertk	C	T	2: 128,601,086 (GRCm39)	R357W	probably damaging	Het
Mesd	T	A	7: 83,544,835 (GRCm39)	I104N	probably damaging	Het
Mrm3	T	A	11: 76,140,781 (GRCm39)	V263E	possibly damaging	Het
Ndst4	T	A	3: 125,405,210 (GRCm39)	Y488*	probably null	Het
Nfat5	C	T	8: 108,065,707 (GRCm39)	R156W	probably damaging	Het
Nfs1	T	C	2: 155,976,444 (GRCm39)	H150R	probably damaging	Het
Odad3	A	T	9: 21,906,353 (GRCm39)	N224K	probably benign	Het
Or1n1b	A	G	2: 36,780,035 (GRCm39)	M275T	probably benign	Het
Or8b56	T	C	9: 38,739,154 (GRCm39)	S50P	possibly damaging	Het
Or8g19	T	A	9: 39,055,399 (GRCm39)	M1K	probably null	Het
Or9q1	A	G	19: 13,804,929 (GRCm39)	F277S	possibly damaging	Het
Pcdh8	T	C	14: 80,004,848 (GRCm39)	Y1059C	probably damaging	Het
Pik3r5	T	A	11: 68,381,306 (GRCm39)	L164Q	probably damaging	Het
Polr3g	T	C	13: 81,824,240 (GRCm39)		probably benign	Het
Ppm1e	T	A	11: 87,122,564 (GRCm39)	K464N	probably benign	Het
Rims1	T	C	1: 22,416,631 (GRCm39)	T1037A	probably damaging	Het
Rpgrip1l	A	T	8: 91,996,750 (GRCm39)	I108N	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,127,419 (GRCm39)		probably benign	Het
Spem1	T	C	11: 69,712,371 (GRCm39)	K98E	possibly damaging	Het
St7l	T	C	3: 104,796,619 (GRCm39)	V237A	probably damaging	Het
Tbc1d16	T	C	11: 119,048,642 (GRCm39)	H337R	probably damaging	Het
Tbc1d32	T	A	10: 55,893,701 (GRCm39)	I1291F	probably benign	Het
Tnfaip6	G	T	2: 51,933,827 (GRCm39)	E61*	probably null	Het
Trib2	A	T	12: 15,843,929 (GRCm39)	W102R	probably damaging	Het
Uimc1	G	T	13: 55,233,457 (GRCm39)	N66K	probably damaging	Het
Vmn1r63	T	A	7: 5,805,838 (GRCm39)	T265S	probably benign	Het
Vps35	G	A	8: 86,021,582 (GRCm39)	T3I	probably benign	Het
Yeats2	T	A	16: 19,975,692 (GRCm39)	L63*	probably null	Het
Zfp282	A	G	6: 47,869,866 (GRCm39)	R304G	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4445:Cntnap2	UTSW	6	46,736,785 (GRCm39)	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6118:Cntnap2	UTSW	6	47,170,011 (GRCm39)	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46,736,694 (GRCm39)	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46,147,206 (GRCm39)	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	45,992,191 (GRCm39)	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CGGTTCCCTTCAAGAACCTCACAG -3'
(R):5'- CAGTGTCAGTCCCAACATTAGCCTC -3'

Sequencing Primer
(F):5'- CCTCACAGAGAGGCAGACTG -3'
(R):5'- CATTTCCAGACTGCACTGATAGG -3'

Posted On

2013-04-11