Incidental Mutation 'R9462:Cntnap2'
ID 714930
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9462 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46234283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 544 (F544L)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: F544L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: F544L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,235,767 T220I probably benign Het
Abca8b T A 11: 109,953,607 H928L Het
Ahnak A T 19: 9,003,935 D861V probably damaging Het
Ahnak2 C A 12: 112,787,035 R89L Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Anks6 A G 4: 47,033,142 L573P unknown Het
Ano5 T C 7: 51,585,452 V711A probably benign Het
Arl2bp C A 8: 94,672,127 A120D probably damaging Het
Asap1 A G 15: 64,166,479 Y223H probably damaging Het
Atp7b A T 8: 22,000,144 M1151K probably damaging Het
B4galnt3 A T 6: 120,294,477 L28Q probably null Het
Ccdc39 T C 3: 33,814,370 K856E probably benign Het
Ccr9 A G 9: 123,779,535 D94G probably damaging Het
Cdan1 A G 2: 120,729,579 I368T possibly damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Chrm3 T C 13: 9,877,401 Y533C Het
Ckap4 C T 10: 84,528,060 E380K possibly damaging Het
Cwh43 A G 5: 73,434,352 K596R probably benign Het
Cyp26c1 A G 19: 37,693,186 E479G probably damaging Het
Deup1 A G 9: 15,582,586 V420A probably benign Het
Dnah3 A G 7: 119,952,300 V2932A probably benign Het
Dthd1 G A 5: 62,882,283 R676H probably benign Het
Eef1e1 A G 13: 38,655,021 L120P probably damaging Het
Elane T C 10: 79,888,049 S244P probably benign Het
Esp6 A G 17: 40,565,424 E121G probably benign Het
Eya1 T C 1: 14,229,551 E326G probably damaging Het
Fam71e2 A G 7: 4,758,331 S461P Het
Fut2 G T 7: 45,651,068 N93K probably damaging Het
Gm12695 A G 4: 96,762,838 V126A probably benign Het
Gm28710 G T 5: 16,822,215 A379S Het
Gucy2g A G 19: 55,233,037 probably null Het
Hbs1l T C 10: 21,342,405 V267A probably damaging Het
Hsd17b1 A T 11: 101,078,980 N106I possibly damaging Het
Ino80d G A 1: 63,058,234 L939F probably damaging Het
Lilra6 A G 7: 3,911,995 W505R probably damaging Het
Map3k14 T A 11: 103,227,534 K609* probably null Het
Mark1 T A 1: 184,919,671 K212N probably damaging Het
Muc5b T A 7: 141,861,479 C2721S Het
Myh4 A G 11: 67,250,985 D890G possibly damaging Het
Mylk2 T G 2: 152,919,453 L492R probably damaging Het
Myt1 T A 2: 181,825,936 Y1134* probably null Het
N4bp2 G A 5: 65,790,555 G176D probably benign Het
Ncstn A C 1: 172,072,140 M325R probably damaging Het
Ndor1 C T 2: 25,254,863 probably null Het
Notch4 G A 17: 34,587,693 R1868H probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1360 A T 13: 21,674,845 V33E probably benign Het
Olfr285 T A 15: 98,313,305 N82Y possibly damaging Het
Oxct2a G T 4: 123,322,648 D313E probably damaging Het
Pcdha2 T A 18: 36,940,493 H392Q probably benign Het
Pcdhb20 T G 18: 37,506,746 L775R probably benign Het
Pclo A G 5: 14,790,394 D1449G Het
Pcx A G 19: 4,601,942 T73A probably benign Het
Pou6f2 A G 13: 18,139,604 S395P probably benign Het
Prss35 C G 9: 86,756,339 I387M Het
Radil C A 5: 142,485,465 D1019Y probably damaging Het
Rnf40 G T 7: 127,591,838 probably null Het
Scarb1 A T 5: 125,340,827 L19Q probably damaging Het
Scn8a T A 15: 101,032,278 F1457I Het
Sdk2 C T 11: 113,869,918 V339I possibly damaging Het
Siglec1 A G 2: 131,074,484 L1182P probably damaging Het
Slc4a4 G A 5: 89,046,272 V204I probably damaging Het
Sp9 T C 2: 73,273,899 S266P probably benign Het
Spata21 A G 4: 141,104,005 E421G probably damaging Het
Sulf1 C T 1: 12,859,235 P242L probably damaging Het
Sval3 G A 6: 41,968,171 G11E possibly damaging Het
Tecta T A 9: 42,337,280 Y1942F probably damaging Het
Thbs2 C T 17: 14,669,981 G1121D probably damaging Het
Thrap3 G T 4: 126,176,255 S613* probably null Het
Ttc34 A C 4: 154,858,082 K59Q probably damaging Het
Ube4b A T 4: 149,360,291 L504Q probably damaging Het
Uncx A T 5: 139,544,016 E8V probably damaging Het
Vmn1r79 A T 7: 12,176,334 I48F probably damaging Het
Vmn2r99 C A 17: 19,378,126 Y137* probably null Het
Zcchc6 A T 13: 59,782,143 L1428H possibly damaging Het
Zfp354b G A 11: 50,923,696 T134I probably benign Het
Zfp618 G A 4: 63,133,273 V764I possibly damaging Het
Zfp873 T G 10: 82,061,297 C621G probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCATTATTAGTAAAATGGCTGTGTCC -3'
(R):5'- GCAGCCATCCATAAGTCCAG -3'

Sequencing Primer
(F):5'- TCCAGTCAAATGTCTGGGAGGC -3'
(R):5'- GCAGCCATCCATAAGTCCAGTTTTTG -3'
Posted On 2022-06-15