Incidental Mutation 'R4030:Cntnap2'
ID 313165
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4030 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 46856128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 758 (F758L)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: F758L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: F758L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,509 S54P probably benign Het
2700062C07Rik C T 18: 24,475,658 P145L probably benign Het
Akap3 A T 6: 126,865,021 D201V probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Bpifb2 T C 2: 153,891,317 S400P probably benign Het
Brd7 A T 8: 88,332,931 I617N probably damaging Het
Cdhr2 C A 13: 54,717,861 P224Q probably damaging Het
Cdon A G 9: 35,491,906 N1104S probably damaging Het
Ceacam3 T C 7: 17,158,342 Y337H probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cpsf1 G A 15: 76,601,779 T397M possibly damaging Het
Crhr2 T C 6: 55,117,677 D32G probably benign Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Dpyd A G 3: 118,897,166 D308G probably benign Het
Dsp A G 13: 38,191,428 N1063S possibly damaging Het
E030030I06Rik C A 10: 22,149,000 G5C unknown Het
Ehbp1 T C 11: 22,285,498 T32A probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbxo9 C A 9: 78,098,341 probably null Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch3 G A 4: 133,578,147 R231H possibly damaging Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
H2-Q6 C A 17: 35,425,816 Q194K probably benign Het
Hmgb1 A G 5: 149,050,700 M13T probably benign Het
Kdm5a T A 6: 120,405,113 L706* probably null Het
Krt12 A T 11: 99,422,028 F63L unknown Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Lgr4 T C 2: 109,989,751 S102P probably benign Het
Loxl4 A T 19: 42,608,359 V71E probably damaging Het
Lrrc36 A C 8: 105,426,807 N83T probably damaging Het
Med26 G A 8: 72,496,569 R229C probably damaging Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mkl1 G A 15: 81,015,784 T729I probably benign Het
Mroh8 T A 2: 157,213,720 D986V probably damaging Het
Mrpl49 T C 19: 6,055,200 D77G probably benign Het
Mrps30 T C 13: 118,380,541 N381D probably damaging Het
Olfr1248 C A 2: 89,617,863 V110F probably damaging Het
Omd T A 13: 49,589,649 N58K probably benign Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Plpp5 T A 8: 25,720,604 L74Q probably damaging Het
Prex2 T A 1: 11,208,568 Y1374N probably benign Het
Rbak A T 5: 143,173,969 I443K probably damaging Het
Rhpn1 A T 15: 75,710,557 S195C probably damaging Het
Rnf115 T A 3: 96,785,983 I210N probably damaging Het
Rock2 G A 12: 16,975,479 V1234I probably damaging Het
Scube2 A G 7: 109,831,771 V407A probably benign Het
Serpina3n G T 12: 104,411,401 probably null Het
Slco2b1 A G 7: 99,682,825 L283P probably damaging Het
Spag1 G A 15: 36,234,301 V736M probably damaging Het
Srebf2 T A 15: 82,178,783 C434S probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Trhr2 T C 8: 122,360,699 M1V probably null Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vmn2r105 T C 17: 20,208,754 R687G probably damaging Het
Vmn2r73 T C 7: 85,871,836 Y308C possibly damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zfyve9 A G 4: 108,719,701 V61A possibly damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGAGTTGCCTCTGAGCCATG -3'
(R):5'- AGATCCATTGGTCCTACTTGTG -3'

Sequencing Primer
(F):5'- GCCATGCTCTGGGGAAAG -3'
(R):5'- TCTTCTGAACAGCCTGGAGAC -3'
Posted On 2015-04-30