Incidental Mutation 'R9563:Bsn'
ID 721244
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108107417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 374 (D374G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: D3146G
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: D3146G

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,187,079 L594V probably benign Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
A2m T A 6: 121,668,050 D953E probably damaging Het
Acod1 A C 14: 103,049,673 Y80S probably damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Akna A G 4: 63,394,707 V393A probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Amz1 T A 5: 140,752,378 D464E probably damaging Het
Anapc1 G A 2: 128,664,060 Q619* probably null Het
Arfgef3 C T 10: 18,646,527 G584R probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atr G C 9: 95,920,780 V1832L probably damaging Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Cc2d1a A G 8: 84,137,129 S562P probably benign Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpb A G 12: 111,299,328 V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Col6a6 C A 9: 105,695,753 G2185C probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cttnbp2 T A 6: 18,367,383 K1645N probably benign Het
Cttnbp2 A T 6: 18,427,468 L738* probably null Het
Cul9 T A 17: 46,509,971 T1927S probably benign Het
Cyfip2 A G 11: 46,260,880 C531R probably benign Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Daam1 A G 12: 71,945,477 E322G unknown Het
Dab2ip T A 2: 35,719,903 L710* probably null Het
Dph1 T C 11: 75,185,999 T60A possibly damaging Het
Eme1 T C 11: 94,650,513 D161G probably benign Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Exoc6 T C 19: 37,599,623 I568T probably damaging Het
F3 T A 3: 121,734,173 L85H Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fbxw14 T C 9: 109,277,267 Y234C probably benign Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Foxr1 T A 9: 44,440,902 probably benign Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdpd4 T C 7: 98,000,162 V450A probably damaging Het
Gm17359 A T 3: 79,449,309 M140L probably benign Het
Greb1 T C 12: 16,724,823 Y191C probably benign Het
Haus3 G A 5: 34,167,956 R120W probably benign Het
Herc1 G T 9: 66,386,911 probably null Het
Hist1h3i T C 13: 21,783,051 D107G probably damaging Het
Hyal2 T C 9: 107,570,645 W166R probably damaging Het
Itga7 C T 10: 128,953,800 A1003V probably damaging Het
Itga8 T A 2: 12,160,408 I797F possibly damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kcnb2 T A 1: 15,709,513 I203N probably damaging Het
Kif21b T A 1: 136,149,428 L396Q probably damaging Het
Kng1 T G 16: 23,060,420 I78S probably damaging Het
Ldlrad4 T C 18: 68,254,480 S288P probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrp1b T A 2: 41,295,699 I1449F Het
Lrrk2 T A 15: 91,749,840 I1380K possibly damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Lyst T C 13: 13,637,823 L940P probably benign Het
Man2a2 T A 7: 80,356,353 M996L probably benign Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Map4k5 A G 12: 69,816,393 V629A probably benign Het
Mapre2 A G 18: 23,890,924 E325G unknown Het
Mbnl1 A G 3: 60,613,294 N101S probably benign Het
Meltf T A 16: 31,885,051 C199S probably damaging Het
Mmab T C 5: 114,436,789 E141G probably benign Het
Mtus2 T C 5: 148,313,407 L1317P Het
Muc6 T A 7: 141,637,870 T2297S possibly damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Nek1 A G 8: 61,124,123 E1118G probably benign Het
Nrtn A G 17: 56,751,416 V195A probably damaging Het
Nsd3 G A 8: 25,714,203 V420I Het
Olfr1094 A G 2: 86,828,754 M1V probably null Het
Olfr1451 T A 19: 12,999,619 I211N probably damaging Het
Olfr205 T C 16: 59,329,402 I36V probably benign Het
Olfr522 G A 7: 140,162,320 T210I probably damaging Het
Olfr618 A T 7: 103,598,018 Q234L probably benign Het
Olfr677 T C 7: 105,057,074 L276P possibly damaging Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr923 A T 9: 38,827,718 H3L probably benign Het
Pde10a G T 17: 8,801,878 A216S unknown Het
Phldb2 T C 16: 45,824,884 T400A possibly damaging Het
Pkd1l1 T A 11: 8,865,502 T1920S Het
Ptgs2 T A 1: 150,105,668 N567K probably benign Het
Pwp1 T A 10: 85,876,506 D141E probably damaging Het
Rab3ip T C 10: 116,918,763 E296G probably null Het
Rb1cc1 A G 1: 6,244,115 K337R probably benign Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 T C 7: 109,038,790 E253G possibly damaging Het
Rictor A T 15: 6,768,081 N306I possibly damaging Het
Rnf214 A T 9: 45,899,843 V174E possibly damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rrad A G 8: 104,628,692 F228S probably damaging Het
Scn3a A T 2: 65,461,251 M1717K probably damaging Het
Scn3b A G 9: 40,282,433 D152G probably benign Het
Scn5a C A 9: 119,486,737 R1635L probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Shprh T A 10: 11,166,491 Y739* probably null Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc7a12 A G 3: 14,499,300 I349V possibly damaging Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Sltm C T 9: 70,573,559 A231V unknown Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Soga1 G A 2: 157,060,262 R278C probably damaging Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Ssbp1 T A 6: 40,478,034 S142R probably benign Het
Stard3 A G 11: 98,379,971 probably null Het
Strn3 G T 12: 51,627,517 H531N possibly damaging Het
Stx17 A G 4: 48,180,739 T195A probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmed5 A C 5: 108,132,234 probably null Het
Tmem132a C T 19: 10,861,596 R494H probably benign Het
Tom1 A G 8: 75,060,549 K406E probably benign Het
Trav5d-4 A T 14: 53,002,016 N43Y probably damaging Het
Trbv19 G T 6: 41,179,011 K105N possibly damaging Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Trp53bp2 T A 1: 182,448,813 N786K probably benign Het
Trpc3 A G 3: 36,651,534 M504T probably benign Het
Ttc28 A T 5: 111,223,226 M545L probably benign Het
Uggt1 A C 1: 36,165,546 V996G possibly damaging Het
Vmn2r65 G A 7: 84,940,672 Q679* probably null Het
Wdfy4 T C 14: 32,970,876 I2958V Het
Zbtb37 C T 1: 161,020,270 S389N possibly damaging Het
Zfp235 T C 7: 24,142,244 V696A possibly damaging Het
Zzef1 T A 11: 72,874,906 C1420S probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9098:Bsn UTSW 9 108112974 missense possibly damaging 0.65
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9307:Bsn UTSW 9 108115794 missense probably benign 0.01
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108113601 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGCTGCTTCGATCACTG -3'
(R):5'- GTGGACCAACTCAAAATGGATTTC -3'

Sequencing Primer
(F):5'- TTCGATCACTGCCCCGG -3'
(R):5'- TGGATTTCCAGCCCACCAG -3'
Posted On 2022-08-09