Incidental Mutation 'R9671:Myo3b'
ID 728029
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70256564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 852 (H852R)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: H852R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: H852R

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: H824R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: H824R

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,605 L228* probably null Het
Acsf2 T C 11: 94,569,976 D368G probably benign Het
Adat2 T A 10: 13,562,708 N177K probably damaging Het
Adgrf5 G T 17: 43,449,904 R830M probably damaging Het
Apoh G A 11: 108,395,966 W72* probably null Het
Bcl2l12 G T 7: 44,992,877 P195Q probably damaging Het
Cacna1b T C 2: 24,706,270 M470V probably benign Het
Ccdc188 A T 16: 18,218,404 R79* probably null Het
Cd34 T A 1: 194,959,193 M309K probably damaging Het
Clec4a2 A T 6: 123,124,983 K32N possibly damaging Het
Csmd3 G T 15: 47,981,903 P88H Het
Def6 A G 17: 28,219,781 S154G probably benign Het
Dot1l T C 10: 80,784,779 L530P probably damaging Het
Fam13a A G 6: 58,974,029 probably null Het
Fat3 G A 9: 16,375,575 A884V possibly damaging Het
Frem3 C A 8: 80,612,505 H476N probably benign Het
Gm3404 T C 5: 146,526,221 V71A probably benign Het
Hnf4g T G 3: 3,638,213 S53R probably benign Het
Ighv13-2 T C 12: 114,358,176 N15D probably benign Het
Jak1 T C 4: 101,177,729 K339E possibly damaging Het
Klhl35 C G 7: 99,468,495 P82R probably benign Het
Klhl40 T A 9: 121,778,677 V301E probably benign Het
Knl1 A T 2: 119,070,608 N930I probably damaging Het
Ltbp1 A G 17: 75,296,222 probably null Het
Mapk7 T C 11: 61,491,672 D68G probably damaging Het
Olfr575 A T 7: 102,955,426 H58Q probably benign Het
Pkd2 A G 5: 104,489,390 D623G probably damaging Het
Pramef17 A C 4: 143,993,117 I226S probably benign Het
Rfxank T C 8: 70,135,548 T118A probably benign Het
Rxrb T A 17: 34,033,046 probably null Het
Sec14l3 G A 11: 4,075,486 V337M probably damaging Het
Sema3e A G 5: 14,162,203 T98A probably benign Het
Ska1 A T 18: 74,199,939 M136K probably damaging Het
Slc19a3 T C 1: 83,022,576 D240G probably benign Het
Snph T C 2: 151,594,411 Y199C probably damaging Het
Sorl1 A T 9: 42,031,781 I933N possibly damaging Het
Spag16 C A 1: 69,844,336 H75N probably benign Het
Spice1 C T 16: 44,379,308 R708C probably benign Het
Tet3 C A 6: 83,404,154 S344I possibly damaging Het
Trav5-4 A G 14: 53,704,359 E63G possibly damaging Het
Trp73 G A 4: 154,063,946 P337L probably benign Het
Ttn A G 2: 76,948,015 F1343L unknown Het
Vipas39 T C 12: 87,246,211 H320R probably benign Het
Vmn2r4 T C 3: 64,409,850 I156V probably benign Het
Wdr81 T C 11: 75,454,363 D26G probably damaging Het
Zscan4d A T 7: 11,165,018 F111I probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATGATCTCTAAGTCCATGTGTG -3'
(R):5'- AAGCAGCTTGTAGCCCTACAG -3'

Sequencing Primer
(F):5'- CACGTGCAGCAAATACGGTTTTC -3'
(R):5'- TACAGGCCACTACATCTATAAACAG -3'
Posted On 2022-10-06