Incidental Mutation 'R9722:Atrn'
ID 730827
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9722 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130906495-131030333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130961616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 575 (D575E)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: D575E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: D575E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,218,273 I52F probably benign Het
Abcc3 A T 11: 94,359,246 L1017Q probably damaging Het
Antxr2 T C 5: 97,948,327 D366G possibly damaging Het
Astn2 C T 4: 65,913,741 V563I probably benign Het
Baz1a C T 12: 54,900,097 D1228N probably benign Het
Canx A G 11: 50,304,474 S256P probably benign Het
Ccnt2 T A 1: 127,802,188 D267E probably damaging Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Dchs2 A G 3: 83,353,994 Y2523C probably benign Het
Dmxl2 G A 9: 54,416,608 P990L probably benign Het
Dnajc9 T C 14: 20,388,211 I108V probably benign Het
Eif2d T C 1: 131,165,211 probably null Het
Ephb2 T C 4: 136,657,457 D881G probably damaging Het
Esr1 A G 10: 5,001,215 N531S probably benign Het
Fbxo2 G A 4: 148,164,426 R125H probably damaging Het
Foxred1 C T 9: 35,206,004 S277N possibly damaging Het
Gemin5 T C 11: 58,150,592 E518G probably damaging Het
Gm17655 A G 5: 110,046,360 Y519H probably benign Het
Igkv4-57-1 A T 6: 69,544,509 W70R probably damaging Het
Krtap4-13 A G 11: 99,809,354 S160P unknown Het
Map3k3 A G 11: 106,142,535 I205V possibly damaging Het
Map3k4 A C 17: 12,271,636 F303V probably benign Het
Mpdz T C 4: 81,386,267 Q132R probably damaging Het
Myo10 T A 15: 25,801,141 V1472E probably damaging Het
Nckap1 G A 2: 80,571,224 Q39* probably null Het
Nog A G 11: 89,301,570 S151P probably damaging Het
Obox6 G A 7: 15,834,906 S15F probably benign Het
Odf2 A G 2: 29,923,582 H647R possibly damaging Het
Olfr821 A G 10: 130,033,631 R2G probably benign Het
Pcdhga11 T C 18: 37,757,345 S469P possibly damaging Het
Pcnx4 T C 12: 72,556,265 Y434H probably damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Pglyrp3 A G 3: 92,031,388 K290R possibly damaging Het
Phactr3 G A 2: 178,256,250 E86K probably damaging Het
Piezo1 A C 8: 122,498,758 L530R Het
Pigg A T 5: 108,347,901 I935F possibly damaging Het
Pofut2 T C 10: 77,266,925 S282P possibly damaging Het
Ppfia1 A G 7: 144,517,665 S337P probably benign Het
Sdr16c5 A T 4: 4,005,595 D246E probably benign Het
Sgsm1 T A 5: 113,280,341 H327L possibly damaging Het
Slc39a4 A G 15: 76,616,011 I113T possibly damaging Het
Slc5a7 A G 17: 54,296,957 probably null Het
Snx11 A G 11: 96,771,099 S86P probably benign Het
Srm T A 4: 148,591,788 probably null Het
Tas2r126 T C 6: 42,435,148 I205T possibly damaging Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Tenm3 A T 8: 48,300,814 S851R probably benign Het
Tnip2 A G 5: 34,496,868 V288A probably benign Het
Tpx2 T A 2: 152,891,556 probably null Het
Trim33 C A 3: 103,353,830 T1115K possibly damaging Het
Tspan13 T A 12: 36,024,018 I40F probably damaging Het
Ube2v2 T C 16: 15,577,035 I91V probably benign Het
Vmn1r22 A T 6: 57,900,646 F115L probably benign Het
Vmn2r7 G A 3: 64,690,986 P717S probably damaging Het
Zan T C 5: 137,389,062 T4910A unknown Het
Zfp599 T A 9: 22,249,445 T475S probably damaging Het
Zfp638 T A 6: 83,946,319 F700I probably damaging Het
Zfp985 A C 4: 147,583,161 K162T possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
R9161:Atrn UTSW 2 130935550 missense probably damaging 1.00
R9786:Atrn UTSW 2 130944889 missense probably damaging 1.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTAAAGGAAGTGGCTTACGTATAG -3'
(R):5'- GCAAATTCTACCACCTGGACTTC -3'

Sequencing Primer
(F):5'- GGGGAAATCAAGTATTGCACATTTG -3'
(R):5'- ACCACCTGGACTTCTTTTAAATGGTG -3'
Posted On 2022-10-06