Mutagenetix > Incidental Mutation

Incidental Mutation 'R7913:Atrn'

610647

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7913 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 130970211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 692 (C692Y)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: C692Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: C692Y

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apaf1	A	G	10: 91,060,271	V324A	probably damaging	Het
Aqp8	T	A	7: 123,464,272	I115N	possibly damaging	Het
Card10	A	T	15: 78,781,103	S717T	possibly damaging	Het
Cep78	T	C	19: 15,970,577	S408G	probably benign	Het
Col24a1	G	T	3: 145,431,866	G895*	probably null	Het
Cs	A	T	10: 128,350,441	K34N	possibly damaging	Het
Dchs1	T	C	7: 105,759,228	E1799G	possibly damaging	Het
Dlg5	A	T	14: 24,137,124		probably null	Het
Dpy19l4	A	T	4: 11,265,859	Y696*	probably null	Het
Dync1h1	A	T	12: 110,628,734	N1360I	probably benign	Het
Fgd2	G	T	17: 29,374,045	R423L	probably damaging	Het
Fmo4	T	C	1: 162,794,172	D490G	possibly damaging	Het
Gm13083	T	A	4: 143,615,045	Y15N	possibly damaging	Het
Gm5113	A	T	7: 30,178,223		probably benign	Het
Grid1	T	A	14: 35,569,697	W854R	probably damaging	Het
H2-M1	T	C	17: 36,670,237		probably null	Het
Hivep1	T	A	13: 42,156,366	M694K	probably benign	Het
Hsd17b6	T	C	10: 127,997,776	T79A	possibly damaging	Het
Hspa4	A	C	11: 53,262,307	V761G	probably benign	Het
Ifi203	T	C	1: 173,926,957	Y736C	probably damaging	Het
Mettl9	T	A	7: 121,076,301	L308Q	probably damaging	Het
Miox	A	G	15: 89,336,582	D230G	probably damaging	Het
Ncapd3	T	A	9: 27,048,226	C319*	probably null	Het
Ncs1	C	A	2: 31,287,284		probably null	Het
Nell1	T	A	7: 50,279,522	H392Q	possibly damaging	Het
Nlrp1b	C	A	11: 71,217,711	E321D	possibly damaging	Het
Nlrp9b	A	T	7: 20,045,800	H796L	probably benign	Het
Nudt16l1	C	A	16: 4,939,381	Q53K	possibly damaging	Het
Nyap1	A	G	5: 137,734,969	S601P	probably damaging	Het
Odf2l	C	T	3: 145,153,483	Q634*	probably null	Het
Olfr1023	T	A	2: 85,887,730	L310H	probably damaging	Het
Olfr1150-ps1	A	G	2: 87,846,693	I141V	probably benign	Het
Olfr118	A	T	17: 37,672,108	E28D	probably benign	Het
Olfr1477	T	A	19: 13,503,207	V288E	probably damaging	Het
Olfr205	C	T	16: 59,329,243	D89N	possibly damaging	Het
Olfr381	A	G	11: 73,486,398	V142A	probably benign	Het
Peg3	GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC	GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC	7: 6,709,168		probably benign	Het
Pik3c2b	T	C	1: 133,090,061		probably null	Het
Prl3c1	A	G	13: 27,199,410	I40V	probably benign	Het
R3hdm4	C	T	10: 79,911,945	A229T	probably damaging	Het
Rab3gap2	T	C	1: 185,262,816	S851P	possibly damaging	Het
Ralgapb	A	T	2: 158,465,939	I1056F	probably damaging	Het
Sec16b	T	C	1: 157,529,329	Y36H	probably benign	Het
Setd3	A	T	12: 108,107,665	V451D	probably benign	Het
Slc35e1	T	C	8: 72,484,662	K334R	probably damaging	Het
Synj1	A	T	16: 90,991,427	N184K	possibly damaging	Het
Syt1	T	C	10: 108,642,248	D105G	probably benign	Het
Taar7e	T	A	10: 24,038,004	C131S	possibly damaging	Het
Tead4	A	G	6: 128,243,368		probably null	Het
Tescl	C	A	7: 24,333,651	R83L	probably damaging	Het
Ufd1	G	T	16: 18,814,866	V14F	probably benign	Het
Ugt1a10	T	A	1: 88,055,755	Y92N	probably benign	Het
Vmn2r52	C	A	7: 10,162,950	V532L	probably benign	Het
Vmn2r67	G	A	7: 85,151,828	T300I	possibly damaging	Het
Wt1	T	G	2: 105,166,860	S381A	probably damaging	Het
Zbtb44	C	T	9: 31,054,208	Q305*	probably null	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCTCAGCACCATGTATGTG -3'
(R):5'- TTACCTGCTAACAGCTTCCAGG -3'

Sequencing Primer
(F):5'- CAGCACCATGTATGTGTTCGGC -3'
(R):5'- AGCTTCCAGGAGCCACATG -3'

Posted On

2019-12-20