Incidental Mutation 'R7913:Atrn'
ID610647
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7913 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130970211 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 692 (C692Y)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: C692Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: C692Y

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Gm5113 A T 7: 30,178,223 probably benign Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTCAGCACCATGTATGTG -3'
(R):5'- TTACCTGCTAACAGCTTCCAGG -3'

Sequencing Primer
(F):5'- CAGCACCATGTATGTGTTCGGC -3'
(R):5'- AGCTTCCAGGAGCCACATG -3'
Posted On2019-12-20