Mutagenetix > Incidental Mutation

Incidental Mutation 'R5417:Nlrp3'

427793

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5417 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 59549063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 489 (G489S)

Ref Sequence

ENSEMBL: ENSMUSP00000098707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

probably damaging
Transcript: ENSMUST00000079476
AA Change: G489S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: G489S

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101148
AA Change: G489S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: G489S

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap39	A	G	15: 76,735,101	V761A	possibly damaging	Het
Ccdc47	C	T	11: 106,210,350	R162Q	probably benign	Het
Cfap65	T	C	1: 74,925,100	E563G	probably damaging	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Col17a1	C	A	19: 47,662,390	G732C	probably damaging	Het
Cped1	A	G	6: 22,233,580	I812V	probably null	Het
Dennd1c	CCGCCCCTCGCTGACAGC	CC	17: 57,066,755		probably null	Het
Dgkg	A	T	16: 22,588,331	M168K	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dolpp1	T	C	2: 30,396,237	L18P	probably damaging	Het
Eif3e	A	T	15: 43,265,521	D234E	probably benign	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
Fbxw10	G	A	11: 62,877,164	R942Q	possibly damaging	Het
Flvcr2	T	G	12: 85,747,191	F114V	probably damaging	Het
Gm14443	A	T	2: 175,170,003	C217S	probably damaging	Het
Gphb5	A	T	12: 75,412,972	V83E	possibly damaging	Het
Gpsm1	T	C	2: 26,324,033		probably null	Het
Grik4	A	G	9: 42,671,248	F134S	probably benign	Het
Ibsp	G	A	5: 104,310,469	E291K	possibly damaging	Het
Igfals	T	G	17: 24,880,316	L127R	probably damaging	Het
Igsf9b	CGGCCCCGGCCCAG	CGGCCCCGGCCCAGGCCCCGGCCCAG	9: 27,334,276		probably benign	Het
Iqcf3	T	A	9: 106,554,214	D63V	probably damaging	Het
Klc4	A	G	17: 46,632,031		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mapk8ip2	C	A	15: 89,457,439	D284E	probably benign	Het
Muc5b	A	T	7: 141,858,044	T1576S	unknown	Het
Nr5a1	T	A	2: 38,708,086	Q233L	possibly damaging	Het
Nusap1	G	A	2: 119,647,143	V345I	probably damaging	Het
Olfr1301	A	G	2: 111,754,920	T224A	possibly damaging	Het
Olfr1494	A	G	19: 13,749,853	H249R	probably benign	Het
Olfr612	A	T	7: 103,538,763	V157E	possibly damaging	Het
Oxr1	A	G	15: 41,820,371	T378A	probably benign	Het
Pcdhb12	T	C	18: 37,436,034	F78L	probably benign	Het
Pgm2l1	A	T	7: 100,272,376	I605L	probably benign	Het
Pik3c2g	A	G	6: 139,736,943	I17V	probably benign	Het
Prss39	A	G	1: 34,500,128	S150G	probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Scg3	T	A	9: 75,669,256	Y279F	probably benign	Het
Skiv2l	C	T	17: 34,846,598	V327I	probably damaging	Het
Srfbp1	T	C	18: 52,488,625	C253R	probably benign	Het
Tcirg1	C	T	19: 3,903,509		probably null	Het
Trim37	A	G	11: 87,166,679	Y313C	probably damaging	Het
Ttll9	A	T	2: 153,002,992	M427L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- ATTGTGTGCACGGGGCTAAAG -3'
(R):5'- GAAGATCTGAACAACCTCCTGG -3'

Sequencing Primer
(F):5'- TGGCCCAGACCTCCAAG -3'
(R):5'- CCTGGTCCTTTCCTCACGG -3'

Posted On

2016-09-01