Mutagenetix > Incidental Mutations

Incidental Mutation 'R1643:Lrriq1'

173686

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

039679-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R1643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103214824 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 689 (S689L)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

Predicted Effect

probably benign
Transcript: ENSMUST00000020043
AA Change: S689L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: S689L

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: S689L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: S689L

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220380

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.5%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	T	A	16: 3,907,078	K45*	probably null	Het
Abcc1	T	A	16: 14,413,368	Y457N	probably damaging	Het
Actr3b	A	G	5: 25,812,011	D19G	probably damaging	Het
Adam39	T	C	8: 40,826,486	V638A	possibly damaging	Het
Adamts1	G	T	16: 85,796,817		probably benign	Het
AI661453	A	G	17: 47,467,866		probably benign	Het
Ank3	G	A	10: 69,884,802	S565N	probably benign	Het
Casd1	A	G	6: 4,621,243	E267G	probably benign	Het
Casr	T	C	16: 36,500,205	K527R	probably damaging	Het
Cep128	A	C	12: 91,325,532	S248A	probably damaging	Het
Clic4	A	G	4: 135,238,895	V50A	possibly damaging	Het
Cylc2	C	T	4: 51,225,173	A36V	probably benign	Het
Derl1	T	A	15: 57,878,559	M127L	probably benign	Het
Dnah6	A	G	6: 73,044,752	V3529A	possibly damaging	Het
Dock1	G	T	7: 135,098,779	L1089F	probably damaging	Het
Edil3	T	A	13: 89,289,576		probably null	Het
Ephb1	A	G	9: 101,996,825	V550A	probably damaging	Het
Fam129c	A	G	8: 71,600,164	D94G	probably benign	Het
Fcho2	G	A	13: 98,784,816	T187I	probably benign	Het
Gas6	T	C	8: 13,465,902		probably null	Het
Gdf7	T	C	12: 8,297,971	Y442C	probably damaging	Het
Gm11567	G	A	11: 99,879,797	G187E	unknown	Het
Gm11639	A	T	11: 104,698,978	T134S	probably benign	Het
Gm8674	T	C	13: 49,901,358		noncoding transcript	Het
Ift80	T	A	3: 68,916,157	I591F	probably benign	Het
Kcnn3	C	T	3: 89,520,497	S10L	unknown	Het
Keg1	A	G	19: 12,719,042	I197V	probably benign	Het
Klhdc9	A	G	1: 171,359,466		probably null	Het
Klhl11	A	G	11: 100,463,015	V660A	probably benign	Het
Lamc1	T	C	1: 153,258,072		probably benign	Het
Lrrc73	G	T	17: 46,255,340		probably null	Het
Magi2	A	G	5: 20,705,506		probably benign	Het
Meis1	A	G	11: 19,016,278	S32P	probably benign	Het
Mia2	A	G	12: 59,179,845		probably null	Het
Mlph	T	C	1: 90,941,734	L486P	probably damaging	Het
Myh10	A	G	11: 68,792,010	E1090G	probably damaging	Het
Mylk	T	C	16: 34,875,635	S247P	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Nedd4l	A	G	18: 65,198,641	Y636C	probably damaging	Het
Nfib	A	T	4: 82,498,679	Y40N	probably damaging	Het
Nisch	T	C	14: 31,173,168	D1057G	probably damaging	Het
P3h2	T	C	16: 25,972,291	H475R	probably benign	Het
Pde6c	C	A	19: 38,161,958	T517K	possibly damaging	Het
Piezo2	T	C	18: 63,082,915	I994V	probably benign	Het
Pik3r4	A	G	9: 105,687,152	D1315G	possibly damaging	Het
Pip5k1c	T	G	10: 81,314,994	V46G	probably damaging	Het
Pole	A	G	5: 110,317,845	E1213G	probably damaging	Het
Prl7d1	T	C	13: 27,712,131	S88G	possibly damaging	Het
Prodh	T	A	16: 18,081,069	N72I	probably benign	Het
Prrc2a	G	A	17: 35,156,954	R907C	probably damaging	Het
Ptger2	T	A	14: 44,988,966	M1K	probably null	Het
Samd4b	G	C	7: 28,423,616	Q6E	probably damaging	Het
Sec24a	C	T	11: 51,704,385	R916H	probably benign	Het
Slc12a5	C	A	2: 164,994,027	D865E	probably benign	Het
Slc17a3	T	C	13: 23,857,198		probably benign	Het
Ssrp1	T	C	2: 85,041,185	V317A	possibly damaging	Het
Stim1	A	G	7: 102,386,100	D95G	possibly damaging	Het
Taok2	A	T	7: 126,875,938		probably benign	Het
Tcof1	T	G	18: 60,816,228	K1205T	possibly damaging	Het
Trim43c	C	T	9: 88,847,477	R325C	probably damaging	Het
Trub2	T	G	2: 29,777,936	T231P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uty	T	A	Y: 1,152,054	D724V	probably damaging	Het
Vmn2r98	A	G	17: 19,080,908	D724G	probably damaging	Het
Wdfy3	A	G	5: 101,875,915	I2442T	possibly damaging	Het
Wdfy4	T	C	14: 33,073,585		probably null	Het
Zfp280b	A	G	10: 76,039,610	H441R	probably damaging	Het
Zfp60	A	T	7: 27,736,975	Q7L	probably damaging	Het
Zzef1	T	C	11: 72,826,202	L406S	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGACACCATCAGCTTCAGCCTTTG -3'
(R):5'- TGAATGAACAGTACCCGTGGCAAG -3'

Sequencing Primer
(F):5'- GTCTGCTGTCCTTTTTCCAGAG -3'
(R):5'- TCGGATGAGAATAATAGCTCACC -3'

Posted On

2014-04-24