Mutagenetix > Incidental Mutation

Incidental Mutation 'R9450:Tnrc6b'

714218

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R9450 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80880436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 713 (M713K)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably benign
Transcript: ENSMUST00000067689
AA Change: M713K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: M713K

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
2810004N23Rik	T	C	8: 124,840,476	K229E	probably damaging	Het
4931409K22Rik	T	A	5: 24,549,449	I395F	probably benign	Het
9030624J02Rik	T	C	7: 118,752,895		probably null	Het
Abca8b	T	C	11: 109,969,104	T523A	probably damaging	Het
Adamts18	G	T	8: 113,764,310	D508E	probably benign	Het
Arap2	T	C	5: 62,698,419	E558G	probably benign	Het
Arid4a	A	T	12: 71,072,600	D331V		Het
Ash1l	A	T	3: 89,007,832	K1923M	possibly damaging	Het
Atad2b	T	A	12: 5,013,859	S947T	probably benign	Het
B4galt1	A	T	4: 40,853,804	M1K	probably null	Het
BC025446	T	A	15: 75,220,725	C98S	probably damaging	Het
Ccpg1	G	A	9: 72,997,421	S4N	unknown	Het
Cfap43	A	T	19: 47,897,871	L102M	probably benign	Het
Clic6	T	C	16: 92,530,756	I483T	possibly damaging	Het
Col6a6	A	T	9: 105,784,174	D245E	probably benign	Het
Cpsf7	G	A	19: 10,540,849		probably null	Het
Depdc5	A	G	5: 32,934,010	D721G	probably benign	Het
Dhx29	C	T	13: 112,947,328	T639I	possibly damaging	Het
Dock7	T	C	4: 98,973,189	E1397G	unknown	Het
Dsp	C	T	13: 38,192,403	T1388M	probably damaging	Het
Fam186b	C	T	15: 99,285,544	G73D	probably damaging	Het
Ganab	A	G	19: 8,915,712	D960G	probably damaging	Het
Gm12394	G	T	4: 42,793,833	Q100K	probably benign	Het
Gria1	T	C	11: 57,309,789	V764A	probably damaging	Het
Grk3	T	C	5: 112,915,047	K645E	probably benign	Het
Hecw2	A	T	1: 53,839,029	Y1339*	probably null	Het
Hmcn2	C	A	2: 31,426,833	T3808N	probably damaging	Het
Il20rb	A	T	9: 100,473,002	N129K	possibly damaging	Het
Itgb4	T	C	11: 115,983,271	Y340H	probably damaging	Het
Itgb6	T	C	2: 60,628,028	I460M	probably benign	Het
Kat14	T	C	2: 144,400,819	I599T	possibly damaging	Het
Kif1b	A	C	4: 149,238,010	D817E	probably benign	Het
Lamb2	T	A	9: 108,480,561	C94*	probably null	Het
Larp1	T	C	11: 58,051,064	S743P	probably damaging	Het
Ldlrap1	T	C	4: 134,747,179	N267S	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Ltf	T	C	9: 111,021,996	L92P	probably damaging	Het
Mns1	C	A	9: 72,452,608	Q347K	probably benign	Het
Myof	A	T	19: 37,960,926	F611I	probably damaging	Het
Nop56	T	C	2: 130,275,681	L76P	probably damaging	Het
Nphp1	T	C	2: 127,774,088	H114R		Het
Olfr1280	T	A	2: 111,316,053	N191K	probably benign	Het
Olfr1512	G	C	14: 52,372,653	Y133*	probably null	Het
Olfr390	C	A	11: 73,787,275	N112K	possibly damaging	Het
Park2	C	A	17: 11,838,634	H301N	possibly damaging	Het
Pcdha12	A	G	18: 37,020,939	D237G	probably damaging	Het
Pitpnm3	A	T	11: 72,061,586	M593K	possibly damaging	Het
Plxdc1	C	T	11: 97,954,855	V211I	probably damaging	Het
Prpf38a	A	T	4: 108,572,875	H143Q	probably damaging	Het
Sdk2	T	C	11: 113,806,279	T1769A	probably benign	Het
Stab1	T	C	14: 31,162,939	D153G	possibly damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Top2a	T	C	11: 99,003,608	K966E	possibly damaging	Het
Vars2	T	C	17: 35,662,135	T421A	probably damaging	Het
Vmn1r1	A	T	1: 182,157,205	C298*	probably null	Het
Vwa3a	T	C	7: 120,804,030		probably null	Het
Vwa5b1	G	T	4: 138,588,629	Q601K	possibly damaging	Het
Zbtb46	T	C	2: 181,395,488	K454E	probably damaging	Het
Zfp426	T	C	9: 20,470,281	H470R	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CGGACTGATTTGGACCCTAG -3'
(R):5'- GAAGTCCATCCTTGGTTGGG -3'

Sequencing Primer
(F):5'- TAGGGTGCTCTCAAACACTG -3'
(R):5'- CCATCCTTGGTTGGGTTGGC -3'

Posted On

2022-06-15