Mutagenetix > Incidental Mutation

Incidental Mutation 'R6211:Itga8'

503433

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R6211 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12193509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 555 (T555M)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: T555M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: T555M

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129370

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: T555M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: T555M

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,239,004	H1035Q	possibly damaging	Het
Acin1	A	T	14: 54,644,046	W391R	probably damaging	Het
Arl6ip1	A	T	7: 118,127,250	S18R	probably benign	Het
Armc3	G	A	2: 19,296,803		probably null	Het
Casc1	C	T	6: 145,200,491	R95Q	probably damaging	Het
Ccdc162	G	T	10: 41,630,145	S883*	probably null	Het
Cd300lg	A	G	11: 102,054,169	M358V	possibly damaging	Het
Cdh23	A	G	10: 60,410,821	V949A	possibly damaging	Het
Cenpo	C	T	12: 4,216,733	S126N	probably benign	Het
Chd3	A	T	11: 69,352,677	D1366E	probably damaging	Het
Chd4	A	G	6: 125,101,285	E169G	possibly damaging	Het
Clec1b	A	G	6: 129,401,477	T24A	possibly damaging	Het
Clhc1	A	G	11: 29,578,145	I558V	probably damaging	Het
Col5a2	T	A	1: 45,376,666	R1440S	probably damaging	Het
Cops3	A	G	11: 59,817,901		probably benign	Het
Cxcr4	A	G	1: 128,589,450	V158A	probably damaging	Het
Dnah7a	A	G	1: 53,419,636	M3781T	probably damaging	Het
Elovl5	C	A	9: 77,981,502	T217K	probably damaging	Het
Fbln7	G	T	2: 128,895,340	M358I	probably damaging	Het
Fbxl13	C	T	5: 21,484,021	R763Q	possibly damaging	Het
Gabrr3	C	A	16: 59,448,108	N361K	probably benign	Het
Gbp7	A	G	3: 142,545,993	M534V	probably benign	Het
Hcar2	G	A	5: 123,864,954	T162I	probably benign	Het
Hdc	A	T	2: 126,593,977	L658Q	probably damaging	Het
Hivep3	A	G	4: 120,098,405	Y1306C	probably damaging	Het
Homer3	C	T	8: 70,285,524	R49C	probably damaging	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Iqgap3	A	G	3: 88,091,515	N308D	probably benign	Het
Lrfn5	G	T	12: 61,839,470	V15L	probably benign	Het
Lrrk1	T	C	7: 66,302,710	K493E	possibly damaging	Het
Lyzl6	A	G	11: 103,635,063	I77T	probably damaging	Het
Mavs	G	T	2: 131,240,391	R65L	probably damaging	Het
Mdn1	T	G	4: 32,696,269	D1217E	probably benign	Het
Olfr103	A	T	17: 37,336,708	F175I	possibly damaging	Het
Olfr1502	A	G	19: 13,862,574	I260M	probably benign	Het
Olfr648	A	T	7: 104,179,747	Y220*	probably null	Het
Otof	C	A	5: 30,371,900	V1762L	probably damaging	Het
Pcdha12	T	C	18: 37,020,321	L31P	probably damaging	Het
Pxk	C	A	14: 8,163,952	P515T	probably damaging	Het
Qrich2	A	T	11: 116,453,542	D1759E	probably benign	Het
Rps6ka1	A	T	4: 133,869,306	F33Y	probably damaging	Het
Rxfp2	G	A	5: 150,044,126		probably null	Het
Slc23a4	A	T	6: 34,956,961	I202N	probably damaging	Het
Slc24a5	A	T	2: 125,088,251	I491F	probably benign	Het
Slco1a1	T	A	6: 141,909,049	K625N	probably benign	Het
Snx31	A	G	15: 36,546,885	V51A	probably damaging	Het
Sox6	G	T	7: 115,801,462	H48Q	probably damaging	Het
Tas2r109	A	T	6: 132,980,624	Y114*	probably null	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Timm13	A	C	10: 80,900,480		probably null	Het
Tpsb2	G	A	17: 25,367,763	A250T	possibly damaging	Het
Trpm6	T	C	19: 18,783,128	I131T	probably damaging	Het
Vars2	A	T	17: 35,665,662		probably null	Het
Vmn2r35	T	A	7: 7,786,528	I737F	probably damaging	Het
Wdr46	C	A	17: 33,944,485	T339K	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGTCTCCTCCCGGAAAAGTG -3'
(R):5'- ATCACCATCCTGAAGTGAGCC -3'

Sequencing Primer
(F):5'- TCCATGGCAAGCATGATGGTTAAC -3'
(R):5'- CCCAGCATGGTTTTGTGT -3'

Posted On

2018-02-27