Mutagenetix > Incidental Mutation

Incidental Mutation 'R7871:Cntnap3'

608129

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R7871 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 64903773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 23 (L23R)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably benign
Transcript: ENSMUST00000091554
AA Change: L23R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: L23R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	A	G	5: 113,183,226	S1041P	probably benign	Het
Aatf	ACACACACACACACACACACACACACACACACACACACACACACACACAC	ACACACACACACACACACACACACACACACACACACACACACACACACACAC	11: 84,471,038		probably null	Het
Arpin	A	T	7: 79,927,715	W195R	probably damaging	Het
Asap1	A	G	15: 64,092,076	V1091A	probably damaging	Het
Asxl3	A	G	18: 22,524,224	T1764A	not run	Het
Bmp7	C	A	2: 172,939,991	A27S	probably benign	Het
Ccnh	T	A	13: 85,211,872	Y297*	probably null	Het
Ccno	C	A	13: 112,988,113	D72E	probably benign	Het
Cd70	T	G	17: 57,148,770	T67P	probably damaging	Het
Chml	CTGTTTG	CTG	1: 175,687,400		probably null	Het
Chst4	A	G	8: 110,030,913	F106S	probably damaging	Het
Crybg2	T	A	4: 134,087,599	L1288H	probably damaging	Het
Cse1l	T	A	2: 166,935,671		probably null	Het
Cyfip2	T	C	11: 46,242,350	H841R	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp4f18	G	A	8: 71,988,643	P498S	possibly damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dnah3	T	A	7: 119,967,552	I97F		Het
Entpd3	A	G	9: 120,560,586	R313G	possibly damaging	Het
Erg28	G	A	12: 85,819,479	T75I	probably damaging	Het
Fam171a1	A	G	2: 3,225,384	H518R	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Galntl6	T	C	8: 57,837,188	E457G	probably damaging	Het
Glt8d1	A	T	14: 31,010,339	H192L	probably damaging	Het
Gm15446	T	A	5: 109,943,299	C472*	probably null	Het
Gm28363	A	T	1: 117,697,498	M1L	unknown	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gstp3	T	A	19: 4,058,746	K45*	probably null	Het
Hsd17b13	A	G	5: 103,965,815	F258L	possibly damaging	Het
Htt	T	C	5: 34,864,649	S1646P	probably benign	Het
Ipo11	T	C	13: 106,892,468	M326V	probably benign	Het
Itpr3	T	A	17: 27,117,179	I2293N	probably damaging	Het
Klk8	A	G	7: 43,799,326		probably null	Het
Kntc1	T	A	5: 123,784,227	L963H	probably damaging	Het
Lyst	T	A	13: 13,636,052	L769*	probably null	Het
Map3k13	A	G	16: 21,921,596	S558G	probably benign	Het
Mbd1	G	A	18: 74,274,057		probably null	Het
Mep1a	T	C	17: 43,479,235	N408D	probably benign	Het
Mtrf1	A	G	14: 79,406,938	T229A	probably benign	Het
Muc4	C	T	16: 32,754,935	S1603L	unknown	Het
Myo1b	A	C	1: 51,779,580	I512S	possibly damaging	Het
N4bp2	A	G	5: 65,807,103	I832V	probably benign	Het
Nadsyn1	T	A	7: 143,798,496	K618*	probably null	Het
Ncstn	T	C	1: 172,075,456	D87G	probably benign	Het
Neurl4	T	C	11: 69,903,186	V156A	probably benign	Het
Nfasc	C	A	1: 132,600,013	G885V	not run	Het
Nox4	A	T	7: 87,314,127	Y180F	possibly damaging	Het
Nuggc	A	G	14: 65,623,251	T449A	probably benign	Het
Olfr799	A	G	10: 129,647,412	I95V	probably benign	Het
Pik3r4	T	C	9: 105,663,117	S735P	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,909	I645T	probably damaging	Het
Rras2	G	A	7: 114,117,548		probably benign	Het
Rtel1	T	C	2: 181,321,029	M25T	probably damaging	Het
Serpinb3c	T	A	1: 107,273,153	Y178F	possibly damaging	Het
Sh3bp2	A	G	5: 34,559,085	H280R	not run	Het
Six4	CT	C	12: 73,104,239		probably benign	Het
Skor1	T	C	9: 63,146,501	E62G	probably damaging	Het
Slc22a22	T	A	15: 57,263,355	N106I	possibly damaging	Het
Slc44a4	T	A	17: 34,923,852		probably null	Het
Sppl2c	A	G	11: 104,188,516		probably null	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Stx5a	T	A	19: 8,755,118	W384R	unknown	Het
Topaz1	A	G	9: 122,780,700	Y1111C	possibly damaging	Het
Ttbk1	T	A	17: 46,446,238	M1157L	probably benign	Het
Ttn	T	C	2: 76,717,215	T32204A	probably benign	Het
Ttn	T	C	2: 76,748,145	T24135A	probably damaging	Het
Ttn	T	C	2: 76,965,137	E632G	unknown	Het
Vmn2r109	T	C	17: 20,540,520	I858M	probably benign	Het
Vmn2r71	A	T	7: 85,623,661	Q561L	possibly damaging	Het
Yme1l1	A	G	2: 23,181,065	D271G	probably damaging	Het
Zfp629	A	G	7: 127,611,995	F214S	probably damaging	Het
Zfp709	A	G	8: 71,889,464	I246V	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCTCAGAAGATGAAAGTCTATCG -3'
(R):5'- AGCCTGTGAGTTGCAAGAG -3'

Sequencing Primer
(F):5'- TTTTCAGGTTGCAACTGAATAGG -3'
(R):5'- CCTGTGAGTTGCAAGAGGAAAGC -3'

Posted On

2019-12-20