Mutagenetix > Incidental Mutation

Incidental Mutation 'R0104:Rif1'

64140

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

D2Ertd145e, 6530403D07Rik, 5730435J01Rik

MMRRC Submission

038390-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0104 (G1)

Quality Score

109

Status

Not validated

Chromosome

Chromosomal Location

51962844-52012395 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52000104 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1186 (L1186S)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: L1186S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: L1186S

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112693
AA Change: L1186S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: L1186S

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dnah5	A	T	15: 28,453,499 (GRCm39)	E4423D	possibly damaging	Het
Fsip2	A	T	2: 82,809,317 (GRCm39)	T1879S	possibly damaging	Het
Gm136	G	T	4: 34,746,593 (GRCm39)	H139Q	possibly damaging	Het
Ifrd2	T	A	9: 107,465,116 (GRCm39)	L10H	probably damaging	Het
Itpr3	C	A	17: 27,314,966 (GRCm39)	H704Q	probably benign	Het
Kcng1	A	G	2: 168,110,966 (GRCm39)	I66T	probably damaging	Het
Kcnv2	T	C	19: 27,300,619 (GRCm39)	Y157H	probably damaging	Het
Leng8	A	G	7: 4,146,807 (GRCm39)	D443G	probably damaging	Het
Mlst8	T	C	17: 24,695,091 (GRCm39)	N264S	possibly damaging	Het
Pcdhb8	A	G	18: 37,488,718 (GRCm39)	E132G	probably benign	Het
Pmpcb	C	G	5: 21,951,036 (GRCm39)	S266*	probably null	Het
Prmt7	T	C	8: 106,963,982 (GRCm39)	I292T	probably damaging	Het
Sox30	A	C	11: 45,872,141 (GRCm39)	E332A	possibly damaging	Het
Taf2	T	C	15: 54,901,734 (GRCm39)	D820G	probably benign	Het
Tas2r120	T	A	6: 132,634,809 (GRCm39)		probably null	Het
Zfp655	T	C	5: 145,180,825 (GRCm39)	S228P	probably damaging	Het
Zfyve9	C	A	4: 108,575,360 (GRCm39)	D574Y	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52,011,019 (GRCm39)	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52,001,082 (GRCm39)	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52,009,129 (GRCm39)	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	51,975,152 (GRCm39)	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	51,985,960 (GRCm39)	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52,001,315 (GRCm39)	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52,001,534 (GRCm39)	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52,002,555 (GRCm39)	missense	probably benign	0.07
IGL02441:Rif1	APN	2	51,995,527 (GRCm39)	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52,006,708 (GRCm39)	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	51,967,077 (GRCm39)	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52,000,137 (GRCm39)	nonsense	probably null
IGL03060:Rif1	APN	2	52,002,149 (GRCm39)	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	51,993,634 (GRCm39)	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	51,980,273 (GRCm39)	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	51,967,000 (GRCm39)	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52,002,611 (GRCm39)	missense	probably benign	0.32
hifi	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
nietzsche	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52,001,970 (GRCm39)	missense
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0268:Rif1	UTSW	2	51,980,298 (GRCm39)	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0278:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0288:Rif1	UTSW	2	52,000,025 (GRCm39)	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0345:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0346:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0383:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0387:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0388:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0456:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0477:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0505:Rif1	UTSW	2	52,000,749 (GRCm39)	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0511:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0633:Rif1	UTSW	2	52,002,575 (GRCm39)	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0638:Rif1	UTSW	2	52,001,600 (GRCm39)	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0675:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0707:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0726:Rif1	UTSW	2	52,000,365 (GRCm39)	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0744:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0938:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0939:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0940:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0941:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0942:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0943:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1006:Rif1	UTSW	2	51,975,041 (GRCm39)	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52,001,574 (GRCm39)	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1175:Rif1	UTSW	2	51,997,640 (GRCm39)	unclassified	probably benign
R1183:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1184:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1271:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1332:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1336:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52,001,567 (GRCm39)	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1527:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1560:Rif1	UTSW	2	52,001,143 (GRCm39)	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	51,963,235 (GRCm39)	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1625:Rif1	UTSW	2	51,993,652 (GRCm39)	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1689:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1731:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1744:Rif1	UTSW	2	52,002,404 (GRCm39)	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1748:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1831:Rif1	UTSW	2	51,968,507 (GRCm39)	nonsense	probably null
R1902:Rif1	UTSW	2	52,006,685 (GRCm39)	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	51,988,421 (GRCm39)	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2000:Rif1	UTSW	2	51,971,310 (GRCm39)	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	51,982,358 (GRCm39)	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2109:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2125:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2126:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2145:Rif1	UTSW	2	52,001,412 (GRCm39)	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2153:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2213:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2327:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2513:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2516:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2520:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2905:Rif1	UTSW	2	51,988,516 (GRCm39)	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	51,972,776 (GRCm39)	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3156:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3429:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3707:Rif1	UTSW	2	51,983,592 (GRCm39)	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52,002,557 (GRCm39)	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52,006,759 (GRCm39)	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52,011,099 (GRCm39)	missense	probably benign	0.01
R4052:Rif1	UTSW	2	51,988,483 (GRCm39)	nonsense	probably null
R4668:Rif1	UTSW	2	52,001,964 (GRCm39)	missense	probably benign	0.01
R4674:Rif1	UTSW	2	51,996,954 (GRCm39)	missense	probably null	1.00
R4715:Rif1	UTSW	2	51,963,151 (GRCm39)	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	51,988,946 (GRCm39)	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	51,983,623 (GRCm39)	intron	probably benign
R4911:Rif1	UTSW	2	52,000,530 (GRCm39)	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	51,974,998 (GRCm39)	splice site	probably null
R5044:Rif1	UTSW	2	51,999,940 (GRCm39)	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	51,982,307 (GRCm39)	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52,010,321 (GRCm39)	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	51,971,301 (GRCm39)	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52,001,836 (GRCm39)	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52,010,983 (GRCm39)	intron	probably benign
R5476:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	51,988,928 (GRCm39)	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52,011,170 (GRCm39)	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	51,995,651 (GRCm39)	critical splice donor site	probably null
R5987:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	51,975,065 (GRCm39)	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52,009,168 (GRCm39)	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	51,997,681 (GRCm39)	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	51,968,275 (GRCm39)	splice site	probably null
R6928:Rif1	UTSW	2	51,985,973 (GRCm39)	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52,002,703 (GRCm39)	missense	probably benign	0.00
R7003:Rif1	UTSW	2	51,967,001 (GRCm39)	missense	probably benign	0.06
R7310:Rif1	UTSW	2	51,995,631 (GRCm39)	missense	probably benign	0.12
R7549:Rif1	UTSW	2	51,968,519 (GRCm39)	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	51,966,187 (GRCm39)	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	51,978,666 (GRCm39)	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52,006,368 (GRCm39)	missense	probably benign	0.00
R7910:Rif1	UTSW	2	51,968,399 (GRCm39)	nonsense	probably null
R7962:Rif1	UTSW	2	51,964,288 (GRCm39)	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	51,980,290 (GRCm39)	missense	noncoding transcript
R8390:Rif1	UTSW	2	52,000,935 (GRCm39)	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52,002,563 (GRCm39)	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52,001,011 (GRCm39)	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52,001,742 (GRCm39)	missense
R8785:Rif1	UTSW	2	52,000,493 (GRCm39)	missense	probably benign	0.06
R8890:Rif1	UTSW	2	51,988,875 (GRCm39)	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52,000,989 (GRCm39)	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52,001,862 (GRCm39)	missense	probably benign	0.22
R9284:Rif1	UTSW	2	51,998,564 (GRCm39)	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52,001,151 (GRCm39)	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52,010,356 (GRCm39)	missense
R9477:Rif1	UTSW	2	52,001,342 (GRCm39)	missense	probably benign	0.02
R9522:Rif1	UTSW	2	51,971,311 (GRCm39)	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52,000,466 (GRCm39)	missense	probably benign	0.29
R9630:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	51,984,645 (GRCm39)	missense	probably damaging	0.96
X0064:Rif1	UTSW	2	51,964,327 (GRCm39)	missense	probably benign	0.00
Z1177:Rif1	UTSW	2	51,978,660 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAAGATGCCCCGGAGAACTGTG -3'
(R):5'- TGTTCGTGCTACAACTGAGGCTG -3'

Sequencing Primer
(F):5'- CTGTGGAATAGATGAACATTCTGAG -3'
(R):5'- CAGATGTCAGTGATGGCTTAGAC -3'

Posted On

2013-08-06