Incidental Mutation 'R8896:Nup210l'
ID 678008
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90118625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 185 (R185G)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably damaging
Transcript: ENSMUST00000029548
AA Change: R185G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: R185G

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: R185G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: R185G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,252,074 S784A probably benign Het
Ap3d1 T A 10: 80,716,591 H581L probably benign Het
Atp11a T C 8: 12,849,781 Y915H probably damaging Het
Atp4b T C 8: 13,387,514 D213G probably benign Het
Bcl11a A G 11: 24,163,640 S328G probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cadps2 T A 6: 23,410,877 Y685F probably damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 180,130,808 probably benign Het
Cep152 A T 2: 125,566,235 V1396D possibly damaging Het
Ces1c T C 8: 93,106,626 I404V probably benign Het
Cr2 A T 1: 195,169,273 M137K possibly damaging Het
Cyp2d40 T C 15: 82,760,253 Y257C unknown Het
Dennd1c T A 17: 57,074,512 D116V probably damaging Het
Dph2 G A 4: 117,890,378 R270* probably null Het
Dpp8 A C 9: 65,078,036 H792P possibly damaging Het
Dupd1 T C 14: 21,686,695 D113G probably benign Het
Efs T C 14: 54,920,299 E185G possibly damaging Het
Eml3 A G 19: 8,936,692 E480G probably damaging Het
Fam193a A G 5: 34,426,484 T336A probably benign Het
Fermt1 C T 2: 132,941,932 probably benign Het
Galnt4 T A 10: 99,110,093 V560D probably damaging Het
Gbp2b C A 3: 142,603,566 T146K probably damaging Het
Gbp5 C T 3: 142,505,547 T346I probably damaging Het
Glrx G T 13: 75,847,198 C79F probably damaging Het
Glt8d2 T A 10: 82,654,782 T225S probably damaging Het
Grm3 A G 5: 9,512,483 F456L possibly damaging Het
Gse1 T G 8: 120,576,446 S1109A unknown Het
Gstp3 A T 19: 4,058,573 L63Q probably damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Herc4 T A 10: 63,311,507 I801N possibly damaging Het
Ido1 G T 8: 24,587,864 D153E probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnj9 T A 1: 172,325,793 S255C probably damaging Het
Kpna3 T C 14: 61,391,845 N39D probably benign Het
Krt39 A T 11: 99,518,269 S269T probably damaging Het
Lfng G A 5: 140,613,223 V296I probably benign Het
Lrit3 T A 3: 129,791,483 I209F probably damaging Het
Map4k5 T A 12: 69,823,501 D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 P652L probably benign Het
Med30 G A 15: 52,721,120 V145I possibly damaging Het
Megf6 T A 4: 154,242,403 D163E probably damaging Het
Meltf T A 16: 31,890,704 probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mppe1 T C 18: 67,237,401 D75G probably damaging Het
Muc4 C T 16: 32,754,673 P1516S probably benign Het
Myo3b C A 2: 70,238,816 F494L probably damaging Het
Nedd4l A G 18: 65,165,617 T226A probably benign Het
Nod1 A G 6: 54,944,292 V347A probably benign Het
Nup210 A T 6: 91,042,253 probably null Het
Olfr202 A T 16: 59,284,089 M136K probably damaging Het
Olfr62 A T 4: 118,666,305 M263L probably benign Het
Olfr957 A G 9: 39,511,474 L82P probably damaging Het
Oma1 T C 4: 103,353,632 L445S probably damaging Het
Oxsm A T 14: 16,242,677 F31I probably benign Het
Pdcd5 A T 7: 35,647,370 M1K probably null Het
Pkd1l2 T C 8: 117,013,876 T2161A possibly damaging Het
Pla2g3 A T 11: 3,492,151 S404C probably null Het
Plec A G 15: 76,194,360 V60A unknown Het
Prpsap2 A G 11: 61,752,910 S66P possibly damaging Het
Rarb A G 14: 16,436,804 L239P probably damaging Het
Ryr3 A T 2: 112,753,050 Y2845* probably null Het
Spta1 T C 1: 174,217,982 C1569R probably damaging Het
Stard13 G A 5: 151,062,650 S465L probably damaging Het
Tmub1 A T 5: 24,446,682 S80T probably benign Het
Trpv5 A G 6: 41,670,913 F322S probably damaging Het
Vmn2r5 G A 3: 64,503,782 A455V probably benign Het
Washc4 T A 10: 83,570,018 N459K probably damaging Het
Wdr11 C T 7: 129,605,713 R300* probably null Het
Zer1 A G 2: 30,103,418 F559L probably damaging Het
Zfat A T 15: 68,180,670 V425D probably damaging Het
Zfp738 G A 13: 67,669,791 L694F Het
Zfp839 C T 12: 110,868,843 A844V probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATCATTCCAATCTGCGTGTTTTAG -3'
(R):5'- TATCAAGCTGCACACGGATG -3'

Sequencing Primer
(F):5'- GCTTTCCAGGAAACACTTTC -3'
(R):5'- ATGGCTGCTGCTGTCCAG -3'
Posted On 2021-08-02