Incidental Mutation 'R8896:Cr2'
ID 678002
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 195169273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 137 (M137K)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043104
AA Change: M117K

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: M117K

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: M137K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,252,074 S784A probably benign Het
Ap3d1 T A 10: 80,716,591 H581L probably benign Het
Atp11a T C 8: 12,849,781 Y915H probably damaging Het
Atp4b T C 8: 13,387,514 D213G probably benign Het
Bcl11a A G 11: 24,163,640 S328G probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cadps2 T A 6: 23,410,877 Y685F probably damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 180,130,808 probably benign Het
Cep152 A T 2: 125,566,235 V1396D possibly damaging Het
Ces1c T C 8: 93,106,626 I404V probably benign Het
Cyp2d40 T C 15: 82,760,253 Y257C unknown Het
Dennd1c T A 17: 57,074,512 D116V probably damaging Het
Dph2 G A 4: 117,890,378 R270* probably null Het
Dpp8 A C 9: 65,078,036 H792P possibly damaging Het
Dupd1 T C 14: 21,686,695 D113G probably benign Het
Efs T C 14: 54,920,299 E185G possibly damaging Het
Eml3 A G 19: 8,936,692 E480G probably damaging Het
Fam193a A G 5: 34,426,484 T336A probably benign Het
Fermt1 C T 2: 132,941,932 probably benign Het
Galnt4 T A 10: 99,110,093 V560D probably damaging Het
Gbp2b C A 3: 142,603,566 T146K probably damaging Het
Gbp5 C T 3: 142,505,547 T346I probably damaging Het
Glrx G T 13: 75,847,198 C79F probably damaging Het
Glt8d2 T A 10: 82,654,782 T225S probably damaging Het
Grm3 A G 5: 9,512,483 F456L possibly damaging Het
Gse1 T G 8: 120,576,446 S1109A unknown Het
Gstp3 A T 19: 4,058,573 L63Q probably damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Herc4 T A 10: 63,311,507 I801N possibly damaging Het
Ido1 G T 8: 24,587,864 D153E probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnj9 T A 1: 172,325,793 S255C probably damaging Het
Kpna3 T C 14: 61,391,845 N39D probably benign Het
Krt39 A T 11: 99,518,269 S269T probably damaging Het
Lfng G A 5: 140,613,223 V296I probably benign Het
Lrit3 T A 3: 129,791,483 I209F probably damaging Het
Map4k5 T A 12: 69,823,501 D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 P652L probably benign Het
Med30 G A 15: 52,721,120 V145I possibly damaging Het
Megf6 T A 4: 154,242,403 D163E probably damaging Het
Meltf T A 16: 31,890,704 probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mppe1 T C 18: 67,237,401 D75G probably damaging Het
Muc4 C T 16: 32,754,673 P1516S probably benign Het
Myo3b C A 2: 70,238,816 F494L probably damaging Het
Nedd4l A G 18: 65,165,617 T226A probably benign Het
Nod1 A G 6: 54,944,292 V347A probably benign Het
Nup210 A T 6: 91,042,253 probably null Het
Nup210l A G 3: 90,118,625 R185G probably damaging Het
Olfr202 A T 16: 59,284,089 M136K probably damaging Het
Olfr62 A T 4: 118,666,305 M263L probably benign Het
Olfr957 A G 9: 39,511,474 L82P probably damaging Het
Oma1 T C 4: 103,353,632 L445S probably damaging Het
Oxsm A T 14: 16,242,677 F31I probably benign Het
Pdcd5 A T 7: 35,647,370 M1K probably null Het
Pkd1l2 T C 8: 117,013,876 T2161A possibly damaging Het
Pla2g3 A T 11: 3,492,151 S404C probably null Het
Plec A G 15: 76,194,360 V60A unknown Het
Prpsap2 A G 11: 61,752,910 S66P possibly damaging Het
Rarb A G 14: 16,436,804 L239P probably damaging Het
Ryr3 A T 2: 112,753,050 Y2845* probably null Het
Spta1 T C 1: 174,217,982 C1569R probably damaging Het
Stard13 G A 5: 151,062,650 S465L probably damaging Het
Tmub1 A T 5: 24,446,682 S80T probably benign Het
Trpv5 A G 6: 41,670,913 F322S probably damaging Het
Vmn2r5 G A 3: 64,503,782 A455V probably benign Het
Washc4 T A 10: 83,570,018 N459K probably damaging Het
Wdr11 C T 7: 129,605,713 R300* probably null Het
Zer1 A G 2: 30,103,418 F559L probably damaging Het
Zfat A T 15: 68,180,670 V425D probably damaging Het
Zfp738 G A 13: 67,669,791 L694F Het
Zfp839 C T 12: 110,868,843 A844V probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9116:Cr2 UTSW 1 195158669 nonsense probably null
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9497:Cr2 UTSW 1 195168435 missense probably damaging 0.99
R9510:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GGCTTCTTGGGGTGAACTAC -3'
(R):5'- CCAGTGCTATTAACTAGGAAGTCAGG -3'

Sequencing Primer
(F):5'- GGGTGAACTACTTTTGAATGGTTAC -3'
(R):5'- GGATATGATGAGTCACCTCT -3'
Posted On 2021-08-02