Incidental Mutation 'R0837:Man2b1'
ID 77995
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Name mannosidase 2, alpha B1
Synonyms lysosomal alpha-mannosidase
MMRRC Submission 039016-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0837 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 85809899-85824911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85823458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 931 (N931D)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
AlphaFold O09159
Predicted Effect possibly damaging
Transcript: ENSMUST00000034121
AA Change: N931D

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: N931D

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Meta Mutation Damage Score 0.1537 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,333,375 (GRCm39) probably benign Het
4930579C12Rik A G 9: 89,050,260 (GRCm39) noncoding transcript Het
Adam34 T A 8: 44,104,537 (GRCm39) K369N probably benign Het
Ap1g1 T C 8: 110,577,697 (GRCm39) W481R probably damaging Het
Bicdl1 G A 5: 115,869,351 (GRCm39) P26S probably benign Het
Cacna1c A T 6: 118,607,231 (GRCm39) C1224* probably null Het
Cpsf2 C T 12: 101,963,501 (GRCm39) probably benign Het
Cyp11b2 G A 15: 74,725,490 (GRCm39) R210W probably damaging Het
Dock7 C T 4: 98,877,495 (GRCm39) V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 (GRCm39) A2908S probably benign Het
Elane A G 10: 79,722,942 (GRCm39) D116G probably damaging Het
Epb41l2 C T 10: 25,383,714 (GRCm39) R153C probably damaging Het
Gucy2c G A 6: 136,699,418 (GRCm39) P617L probably damaging Het
H2ac21 G A 3: 96,127,439 (GRCm39) A70T probably damaging Het
Kcnq4 T A 4: 120,604,058 (GRCm39) I106L probably benign Het
Mthfs A G 9: 89,097,443 (GRCm39) E100G probably damaging Het
Mto1 A T 9: 78,381,072 (GRCm39) I639F probably damaging Het
Myo15a A G 11: 60,378,077 (GRCm39) E177G probably damaging Het
Naip5 T A 13: 100,367,251 (GRCm39) M282L probably benign Het
Or10aa1 A G 1: 173,870,053 (GRCm39) D179G probably damaging Het
Pik3c2g G A 6: 139,903,425 (GRCm39) probably benign Het
Prl7d1 T A 13: 27,898,321 (GRCm39) M64L probably benign Het
Prnp A T 2: 131,778,444 (GRCm39) N32I probably damaging Het
Ptpn11 C T 5: 121,287,174 (GRCm39) V406I probably benign Het
Rab40c G A 17: 26,103,667 (GRCm39) T151I probably damaging Het
Rb1cc1 T A 1: 6,304,495 (GRCm39) probably null Het
Rnf145 T C 11: 44,415,815 (GRCm39) V10A probably benign Het
Rtn4rl2 T C 2: 84,711,036 (GRCm39) N70S probably damaging Het
Scaper A T 9: 55,766,326 (GRCm39) C483* probably null Het
Sema4a T A 3: 88,360,405 (GRCm39) Q58L possibly damaging Het
Slf1 T C 13: 77,249,067 (GRCm39) probably null Het
Sycp1 G T 3: 102,822,561 (GRCm39) N364K probably benign Het
Tenm4 T C 7: 96,545,482 (GRCm39) probably benign Het
Tnfaip2 A G 12: 111,417,141 (GRCm39) T537A probably damaging Het
Trappc12 A G 12: 28,753,596 (GRCm39) I573T possibly damaging Het
Ugt2b38 G A 5: 87,559,632 (GRCm39) T420I probably damaging Het
Ulk1 A T 5: 110,937,411 (GRCm39) probably benign Het
Unc80 G A 1: 66,688,103 (GRCm39) C2367Y possibly damaging Het
Usp7 C A 16: 8,521,366 (GRCm39) G135C probably damaging Het
Vmn2r103 A G 17: 20,014,189 (GRCm39) Y327C probably damaging Het
Vmn2r28 T A 7: 5,491,026 (GRCm39) H407L probably damaging Het
Zfp804a A C 2: 82,089,506 (GRCm39) T1112P probably damaging Het
Zfr2 A G 10: 81,081,242 (GRCm39) K431E probably damaging Het
Zfy1 A T Y: 725,850 (GRCm39) Y638* probably null Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85,811,267 (GRCm39) splice site probably null
IGL00671:Man2b1 APN 8 85,820,567 (GRCm39) missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85,824,059 (GRCm39) missense probably benign 0.00
dateline UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
greenwich UTSW 8 85,812,085 (GRCm39) nonsense probably null
longitude UTSW 8 85,821,773 (GRCm39) nonsense probably null
meridian UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85,824,118 (GRCm39) missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85,819,645 (GRCm39) missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85,823,405 (GRCm39) missense probably benign
R0727:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
R1087:Man2b1 UTSW 8 85,821,800 (GRCm39) missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85,813,474 (GRCm39) missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85,820,563 (GRCm39) missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85,813,451 (GRCm39) missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85,821,964 (GRCm39) missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85,812,013 (GRCm39) missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85,819,653 (GRCm39) splice site probably benign
R3897:Man2b1 UTSW 8 85,823,577 (GRCm39) splice site probably benign
R3971:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85,817,565 (GRCm39) missense probably benign 0.22
R5183:Man2b1 UTSW 8 85,822,413 (GRCm39) missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85,811,088 (GRCm39) missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85,820,839 (GRCm39) missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85,823,675 (GRCm39) missense probably benign 0.44
R6341:Man2b1 UTSW 8 85,822,028 (GRCm39) missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85,824,076 (GRCm39) missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85,811,108 (GRCm39) missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85,823,482 (GRCm39) missense probably benign 0.01
R6631:Man2b1 UTSW 8 85,813,440 (GRCm39) splice site probably null
R6828:Man2b1 UTSW 8 85,813,548 (GRCm39) missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85,817,700 (GRCm39) splice site probably null
R7159:Man2b1 UTSW 8 85,813,909 (GRCm39) missense probably benign 0.09
R7267:Man2b1 UTSW 8 85,813,804 (GRCm39) missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85,817,594 (GRCm39) nonsense probably null
R7786:Man2b1 UTSW 8 85,812,085 (GRCm39) nonsense probably null
R8022:Man2b1 UTSW 8 85,822,242 (GRCm39) missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85,823,674 (GRCm39) missense probably benign 0.03
R8251:Man2b1 UTSW 8 85,821,758 (GRCm39) missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85,822,907 (GRCm39) missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85,820,772 (GRCm39) missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85,821,782 (GRCm39) missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85,821,773 (GRCm39) nonsense probably null
R8891:Man2b1 UTSW 8 85,811,084 (GRCm39) missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85,818,539 (GRCm39) missense probably benign 0.36
R9059:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
Z1176:Man2b1 UTSW 8 85,820,567 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGAAACAGCTTCCGTCCGCCTC -3'
(R):5'- GCACTGCTCACTGTAAACCTCTGTC -3'

Sequencing Primer
(F):5'- GAAGCCCCTTCCCATTATGC -3'
(R):5'- TCATCCACTTGAGCCTGGAAG -3'
Posted On 2013-10-16