Incidental Mutation 'R9475:Cntnap3'
ID 715729
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R9475 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64736182-64903955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64799135 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 160 (F160S)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: F160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: F160S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A T 7: 46,016,468 W243R probably damaging Het
Ablim1 T G 19: 57,239,180 K18Q probably benign Het
Adamts18 T A 8: 113,777,938 N174Y possibly damaging Het
Agbl2 A G 2: 90,784,093 H23R probably benign Het
Akap6 T G 12: 53,010,552 Y934D probably damaging Het
Alas1 C T 9: 106,234,062 S635N probably benign Het
Ankrd24 A G 10: 81,642,299 probably null Het
Atp6v0a4 A G 6: 38,060,982 L560P probably damaging Het
Cacng1 C T 11: 107,716,292 V34M possibly damaging Het
Clcn3 C T 8: 60,934,517 A233T probably damaging Het
Ctnnd2 A G 15: 30,881,130 S719G probably damaging Het
Exosc2 G A 2: 31,674,743 V107I probably benign Het
Fam83b C A 9: 76,491,803 V673F probably benign Het
Fras1 T C 5: 96,780,070 F3781L probably damaging Het
Gal3st1 T A 11: 3,998,660 L289H probably damaging Het
Garem1 T C 18: 21,148,313 I329V probably benign Het
Gli3 G A 13: 15,725,711 G1228S possibly damaging Het
Gpbp1l1 T C 4: 116,574,361 F72S possibly damaging Het
Hao1 T A 2: 134,548,261 M53L probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Iqcm A G 8: 75,753,455 E347G probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnrg A G 14: 61,607,657 I49V possibly damaging Het
Lrrc8e G A 8: 4,235,346 G524S probably benign Het
Lrrn1 A T 6: 107,568,300 Y353F probably damaging Het
Mdn1 A G 4: 32,739,849 D3701G possibly damaging Het
Mtmr2 A G 9: 13,805,471 T623A probably benign Het
Ndst4 C A 3: 125,714,647 S287* probably null Het
Ntrk3 A C 7: 78,302,732 M579R probably benign Het
Oas1a G A 5: 120,899,254 L237F probably damaging Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr169 T C 16: 19,566,520 D121G probably benign Het
Olfr857 T C 9: 19,713,643 M272T probably benign Het
Paqr5 T A 9: 61,956,225 I272F probably damaging Het
Pcdha11 T A 18: 37,007,538 V740E probably damaging Het
Pdgfra A C 5: 75,167,927 N240T possibly damaging Het
Plbd2 G A 5: 120,494,380 Q186* probably null Het
Plce1 G A 19: 38,777,893 E2121K possibly damaging Het
Ppargc1a C A 5: 51,495,738 G161C probably damaging Het
Ptprk T C 10: 28,334,480 I166T possibly damaging Het
Rhox8 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT X: 37,878,114 probably benign Het
Rpap2 T A 5: 107,620,589 L431Q probably damaging Het
Rslcan18 T A 13: 67,102,064 K160* probably null Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sh2d3c C T 2: 32,753,027 L741F probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint6 C T 4: 112,806,840 probably null Het
Skiv2l A T 17: 34,841,102 D897E probably benign Het
Slc35f3 T C 8: 126,382,254 S181P probably damaging Het
Slc4a9 A T 18: 36,529,216 E127V probably null Het
Spata5 T C 3: 37,431,909 V260A probably benign Het
Speg C T 1: 75,388,091 T372I probably damaging Het
Syce1l A G 8: 113,655,103 T204A probably benign Het
Tas2r138 T A 6: 40,612,458 M285L probably benign Het
Tbc1d10a G C 11: 4,213,604 K285N probably damaging Het
Trim9 T A 12: 70,346,454 M239L probably benign Het
Trp53bp1 A G 2: 121,209,280 S1293P probably benign Het
Uaca C T 9: 60,872,216 T1295M possibly damaging Het
Ubald1 G T 16: 4,875,569 Q161K possibly damaging Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Vps45 T G 3: 96,042,925 T231P probably damaging Het
Wdr17 A T 8: 54,635,477 D1186E probably benign Het
Zfp534 G A 4: 147,682,274 T8I probably benign Het
Zfp68 T C 5: 138,607,255 N269D probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64785343 missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64781759 missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64751718 missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 64903834 missense probably benign 0.41
R9625:Cntnap3 UTSW 13 64858765 missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64751748 missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTAGTAGAAGTCTCATAACACTCG -3'
(R):5'- GACAGCCTTTTGGATATAGGCAGAG -3'

Sequencing Primer
(F):5'- GCAGCATCTCATGCAGAT -3'
(R):5'- CCTTTTGGATATAGGCAGAGTGAAC -3'
Posted On 2022-06-15