Incidental Mutation 'R5043:Cntnap3'
ID393314
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 042633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5043 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64794348 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 189 (F189L)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: F189L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: F189L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,044,100 Y106* probably null Het
1700061G19Rik A G 17: 56,885,198 Y587C probably damaging Het
Akap12 G C 10: 4,355,047 G619A probably damaging Het
Arhgap29 A G 3: 121,974,004 K32E probably benign Het
Capg T A 6: 72,558,254 Y253* probably null Het
Cp T C 3: 19,973,917 S496P probably benign Het
Cxcl11 T C 5: 92,363,152 probably null Het
Dennd3 T C 15: 73,527,936 L217P probably benign Het
Dip2c G T 13: 9,551,827 R274L possibly damaging Het
Dnah12 C T 14: 26,884,190 S3776L probably damaging Het
Emcn A G 3: 137,391,601 T94A possibly damaging Het
Fnip2 A T 3: 79,492,867 Y397* probably null Het
Gabrp T C 11: 33,568,072 N79D probably benign Het
Glmp T G 3: 88,326,676 probably benign Het
Gm12794 T C 4: 101,940,524 F40L possibly damaging Het
Gm5921 C T 9: 115,438,019 noncoding transcript Het
Gm6483 A G 8: 19,693,670 T104A probably benign Het
Ifi206 A T 1: 173,486,718 M52K probably damaging Het
Iqcc T C 4: 129,618,277 probably benign Het
Klra2 T A 6: 131,220,172 H288L probably benign Het
Myo5b T C 18: 74,638,153 probably null Het
Nisch A G 14: 31,176,465 probably benign Het
Nlrp4c A G 7: 6,066,825 N575S probably benign Het
Olfr354 A C 2: 36,906,965 R6S probably benign Het
Olfr913 A G 9: 38,594,841 I207V probably damaging Het
Phlda1 T A 10: 111,507,291 L296Q unknown Het
Rab36 G A 10: 75,051,005 E182K probably benign Het
Rasa3 G A 8: 13,570,368 T767M possibly damaging Het
Serpinb11 G A 1: 107,369,465 V24M probably damaging Het
Slc7a14 T G 3: 31,237,466 N221T probably damaging Het
Smg6 T C 11: 74,929,895 S331P possibly damaging Het
Snx1 C T 9: 66,097,436 A183T probably benign Het
Srpk2 T C 5: 23,524,517 T375A probably benign Het
Tecpr1 T C 5: 144,197,854 probably null Het
Topaz1 A T 9: 122,748,404 E126D probably benign Het
Ugt2b1 C G 5: 86,917,644 C512S possibly damaging Het
Ugt2b37 C T 5: 87,251,860 W263* probably null Het
Utp20 A T 10: 88,798,746 M750K possibly damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp609 T C 9: 65,700,827 Y1257C probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCTGAAAAGATCAAGTATCCACAGATG -3'
(R):5'- CATCAGGGACTTGTCAAACTTTATTGG -3'

Sequencing Primer
(F):5'- CAAGTATCCACAGATGTATTTCCATC -3'
(R):5'- GAGAGATAGGAATAGCATCTCTCTC -3'
Posted On2016-06-15