Incidental Mutation 'R8879:Notch2'
ID 676747
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Name notch 2
Synonyms N2, Motch B
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98013527-98150361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98135599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1427 (S1427G)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
AlphaFold O35516
Predicted Effect possibly damaging
Transcript: ENSMUST00000079812
AA Change: S1427G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: S1427G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 (GRCm38) V326M probably damaging Het
Adap2 T A 11: 80,156,959 (GRCm38) H80Q probably benign Het
Ang4 T C 14: 51,764,486 (GRCm38) T2A probably benign Het
Arf2 T C 11: 103,979,759 (GRCm38) probably null Het
B3gnt4 A G 5: 123,511,148 (GRCm38) D192G probably damaging Het
BC034090 T C 1: 155,226,357 (GRCm38) I54V probably benign Het
Catsper3 A G 13: 55,804,895 (GRCm38) T202A probably benign Het
Cenpe T A 3: 135,260,101 (GRCm38) D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 (GRCm38) V191A probably benign Het
Col5a1 G T 2: 28,014,158 (GRCm38) A1356S unknown Het
Cuzd1 A G 7: 131,308,848 (GRCm38) S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 (GRCm38) M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 (GRCm38) I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 (GRCm38) I232V probably benign Het
Dnah10 A G 5: 124,818,117 (GRCm38) E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 (GRCm38) probably benign Het
Ehd1 A G 19: 6,298,324 (GRCm38) D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 (GRCm38) M766L possibly damaging Het
Eno4 A G 19: 58,970,722 (GRCm38) I613M probably benign Het
Exoc3l A T 8: 105,290,549 (GRCm38) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 80,613,148 (GRCm38) D690V probably damaging Het
Gm11639 T C 11: 104,690,955 (GRCm38) I41T probably benign Het
Gm19410 A T 8: 35,771,868 (GRCm38) D97V probably damaging Het
Grik5 T A 7: 25,023,064 (GRCm38) D540V possibly damaging Het
Hint1 T A 11: 54,869,943 (GRCm38) D69E probably benign Het
Krt13 T C 11: 100,119,385 (GRCm38) T257A probably benign Het
Lpin2 T C 17: 71,242,754 (GRCm38) L676P probably damaging Het
Lrguk A G 6: 34,029,683 (GRCm38) E76G probably benign Het
Lrrc8a A G 2: 30,256,298 (GRCm38) M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 (GRCm38) Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 (GRCm38) L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 (GRCm38) I135T probably damaging Het
Neb T C 2: 52,235,580 (GRCm38) D475G Het
Olfr118 C A 17: 37,672,411 (GRCm38) Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 (GRCm38) V195A probably benign Het
Olfr694 A T 7: 106,689,089 (GRCm38) I214N probably damaging Het
Olfr816 A G 10: 129,911,862 (GRCm38) C139R probably damaging Het
Olfr952 A C 9: 39,426,219 (GRCm38) V284G possibly damaging Het
Opcml T C 9: 28,902,151 (GRCm38) F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 (GRCm38) V729F probably damaging Het
Pias2 C T 18: 77,146,768 (GRCm38) Q565* probably null Het
Pnp T A 14: 50,950,720 (GRCm38) probably null Het
Ptpn18 T C 1: 34,463,130 (GRCm38) S76P probably benign Het
Qtrt2 A T 16: 43,863,197 (GRCm38) L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 (GRCm38) E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 (GRCm38) V1477E probably benign Het
Repin1 C T 6: 48,597,433 (GRCm38) T432I possibly damaging Het
Rest G A 5: 77,282,511 (GRCm38) G926R probably benign Het
Rnft1 T A 11: 86,486,690 (GRCm38) F143L possibly damaging Het
Sema3e A T 5: 14,232,094 (GRCm38) I415L probably benign Het
Slc10a1 T A 12: 80,967,595 (GRCm38) N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 (GRCm38) probably benign Het
Slc2a2 T C 3: 28,713,802 (GRCm38) S160P possibly damaging Het
Srrd A G 5: 112,338,456 (GRCm38) V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 (GRCm38) G198C probably benign Het
Trbv29 G A 6: 41,271,405 (GRCm38) M1I probably null Het
Tril A G 6: 53,819,584 (GRCm38) S218P probably damaging Het
Trip11 T C 12: 101,862,598 (GRCm38) K1749R probably benign Het
Ttc25 G T 11: 100,566,926 (GRCm38) E452* probably null Het
Ttn A G 2: 76,830,651 (GRCm38) V12011A Het
Ubr4 T G 4: 139,410,518 (GRCm38) F1093V probably benign Het
Urb2 C A 8: 124,028,403 (GRCm38) A283E probably benign Het
Usp43 T A 11: 67,898,881 (GRCm38) probably benign Het
Vmn1r28 A T 6: 58,265,684 (GRCm38) I171F probably benign Het
Vps33a G A 5: 123,533,899 (GRCm38) R469W probably damaging Het
Zfp202 G A 9: 40,211,757 (GRCm38) R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 (GRCm38) H158L probably benign Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98,111,675 (GRCm38) missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98,138,655 (GRCm38) missense probably benign 0.16
IGL01630:Notch2 APN 3 98,146,618 (GRCm38) missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98,146,060 (GRCm38) missense probably damaging 1.00
IGL01828:Notch2 APN 3 98,072,613 (GRCm38) missense probably damaging 1.00
IGL01998:Notch2 APN 3 98,143,106 (GRCm38) missense probably damaging 1.00
IGL02008:Notch2 APN 3 98,147,296 (GRCm38) missense probably damaging 1.00
IGL02030:Notch2 APN 3 98,099,421 (GRCm38) splice site probably null
IGL02155:Notch2 APN 3 98,138,490 (GRCm38) missense probably damaging 0.98
IGL02268:Notch2 APN 3 98,137,397 (GRCm38) missense probably damaging 1.00
IGL02301:Notch2 APN 3 98,141,554 (GRCm38) missense probably benign 0.08
IGL02336:Notch2 APN 3 98,138,395 (GRCm38) missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98,147,336 (GRCm38) nonsense probably null
IGL02536:Notch2 APN 3 98,102,407 (GRCm38) missense probably benign 0.03
IGL02589:Notch2 APN 3 98,104,347 (GRCm38) critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98,116,697 (GRCm38) splice site probably benign
IGL02691:Notch2 APN 3 98,135,607 (GRCm38) nonsense probably null
IGL02832:Notch2 APN 3 98,137,373 (GRCm38) missense probably benign 0.12
IGL02894:Notch2 APN 3 98,102,432 (GRCm38) nonsense probably null
IGL02902:Notch2 APN 3 98,111,574 (GRCm38) missense probably damaging 1.00
IGL02967:Notch2 APN 3 98,146,144 (GRCm38) missense probably damaging 0.99
IGL03015:Notch2 APN 3 98,072,649 (GRCm38) missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98,142,956 (GRCm38) missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98,098,108 (GRCm38) missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98,104,462 (GRCm38) missense probably damaging 1.00
R0111:Notch2 UTSW 3 98,138,761 (GRCm38) missense probably benign 0.00
R0129:Notch2 UTSW 3 98,146,620 (GRCm38) missense probably benign 0.08
R0143:Notch2 UTSW 3 98,146,117 (GRCm38) missense probably damaging 0.99
R0480:Notch2 UTSW 3 98,146,537 (GRCm38) missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98,111,598 (GRCm38) missense probably benign 0.00
R0523:Notch2 UTSW 3 98,070,970 (GRCm38) missense probably benign 0.34
R0531:Notch2 UTSW 3 98,102,451 (GRCm38) splice site probably benign
R0537:Notch2 UTSW 3 98,116,741 (GRCm38) missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98,134,677 (GRCm38) splice site probably null
R1485:Notch2 UTSW 3 98,100,257 (GRCm38) missense probably benign 0.00
R1555:Notch2 UTSW 3 98,131,340 (GRCm38) missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98,111,575 (GRCm38) missense probably damaging 1.00
R1699:Notch2 UTSW 3 98,145,127 (GRCm38) missense probably damaging 1.00
R1765:Notch2 UTSW 3 98,121,926 (GRCm38) missense probably damaging 1.00
R1794:Notch2 UTSW 3 98,099,547 (GRCm38) missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98,072,755 (GRCm38) missense probably damaging 1.00
R2086:Notch2 UTSW 3 98,102,367 (GRCm38) missense probably damaging 1.00
R2099:Notch2 UTSW 3 98,115,321 (GRCm38) missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98,146,623 (GRCm38) missense probably damaging 1.00
R3924:Notch2 UTSW 3 98,122,034 (GRCm38) nonsense probably null
R4018:Notch2 UTSW 3 98,104,565 (GRCm38) missense probably damaging 1.00
R4151:Notch2 UTSW 3 98,147,071 (GRCm38) missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98,131,270 (GRCm38) missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98,146,321 (GRCm38) missense probably benign 0.02
R4511:Notch2 UTSW 3 98,146,321 (GRCm38) missense probably benign 0.02
R4636:Notch2 UTSW 3 98,146,104 (GRCm38) missense probably benign 0.02
R4661:Notch2 UTSW 3 98,135,513 (GRCm38) missense probably damaging 1.00
R4856:Notch2 UTSW 3 98,102,419 (GRCm38) missense probably damaging 1.00
R4886:Notch2 UTSW 3 98,102,419 (GRCm38) missense probably damaging 1.00
R4945:Notch2 UTSW 3 98,111,721 (GRCm38) missense probably benign 0.01
R4970:Notch2 UTSW 3 98,101,636 (GRCm38) critical splice donor site probably null
R4974:Notch2 UTSW 3 98,139,633 (GRCm38) missense probably benign 0.39
R5082:Notch2 UTSW 3 98,100,374 (GRCm38) missense probably damaging 1.00
R5112:Notch2 UTSW 3 98,101,636 (GRCm38) critical splice donor site probably null
R5156:Notch2 UTSW 3 98,124,310 (GRCm38) missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98,126,134 (GRCm38) missense probably damaging 1.00
R5539:Notch2 UTSW 3 98,137,582 (GRCm38) missense probably damaging 0.99
R5813:Notch2 UTSW 3 98,135,428 (GRCm38) missense probably benign
R5827:Notch2 UTSW 3 98,072,862 (GRCm38) missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98,123,923 (GRCm38) intron probably benign
R6021:Notch2 UTSW 3 98,121,972 (GRCm38) missense probably damaging 1.00
R6090:Notch2 UTSW 3 98,135,377 (GRCm38) nonsense probably null
R6103:Notch2 UTSW 3 98,135,743 (GRCm38) missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98,146,293 (GRCm38) missense probably benign 0.00
R6168:Notch2 UTSW 3 98,145,217 (GRCm38) missense probably damaging 1.00
R6382:Notch2 UTSW 3 98,141,543 (GRCm38) missense probably damaging 1.00
R6404:Notch2 UTSW 3 98,081,998 (GRCm38) missense probably damaging 1.00
R6419:Notch2 UTSW 3 98,100,389 (GRCm38) critical splice donor site probably null
R6454:Notch2 UTSW 3 98,137,406 (GRCm38) missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98,101,605 (GRCm38) missense probably damaging 1.00
R6629:Notch2 UTSW 3 98,120,881 (GRCm38) missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98,138,430 (GRCm38) missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98,134,586 (GRCm38) missense probably damaging 1.00
R6837:Notch2 UTSW 3 98,070,854 (GRCm38) splice site probably null
R7021:Notch2 UTSW 3 98,135,446 (GRCm38) missense probably benign
R7028:Notch2 UTSW 3 98,102,387 (GRCm38) missense probably damaging 1.00
R7228:Notch2 UTSW 3 98,137,317 (GRCm38) nonsense probably null
R7320:Notch2 UTSW 3 98,131,327 (GRCm38) missense possibly damaging 0.94
R7361:Notch2 UTSW 3 98,131,402 (GRCm38) missense probably benign 0.04
R7562:Notch2 UTSW 3 98,113,114 (GRCm38) missense probably damaging 1.00
R7630:Notch2 UTSW 3 98,137,508 (GRCm38) missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98,146,623 (GRCm38) missense probably damaging 1.00
R7748:Notch2 UTSW 3 98,138,484 (GRCm38) missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98,142,988 (GRCm38) missense probably damaging 1.00
R7817:Notch2 UTSW 3 98,107,127 (GRCm38) missense probably damaging 1.00
R7952:Notch2 UTSW 3 98,100,236 (GRCm38) missense probably benign 0.30
R8136:Notch2 UTSW 3 98,124,221 (GRCm38) missense probably damaging 1.00
R8159:Notch2 UTSW 3 98,120,922 (GRCm38) missense possibly damaging 0.95
R8679:Notch2 UTSW 3 98,121,902 (GRCm38) critical splice acceptor site probably null
R9146:Notch2 UTSW 3 98,104,538 (GRCm38) missense probably damaging 1.00
R9398:Notch2 UTSW 3 98,102,352 (GRCm38) missense probably damaging 1.00
R9422:Notch2 UTSW 3 98,147,352 (GRCm38) missense probably damaging 1.00
R9594:Notch2 UTSW 3 98,134,573 (GRCm38) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGTATCCACACTGACTCGGG -3'
(R):5'- TCAAAGTTGTCAAACAGGCACTC -3'

Sequencing Primer
(F):5'- CTTCTGCCTGAACCCCAAGG -3'
(R):5'- ACTCTGCGGTGTTGCAC -3'
Posted On 2021-07-15