Incidental Mutation 'R9101:Aox2'
ID 691664
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9101 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58332637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 820 (P820L)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: P820L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: P820L

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,049,395 I39N probably damaging Het
AA792892 G A 5: 94,384,040 C261Y probably damaging Het
Adam6b T C 12: 113,491,756 V731A probably benign Het
Adamts7 T C 9: 90,189,741 probably null Het
Afdn T C 17: 13,823,444 V388A probably damaging Het
Alg3 A G 16: 20,608,849 Y113H possibly damaging Het
Avil A G 10: 127,017,004 D731G probably benign Het
Blvra C T 2: 127,085,970 L47F probably damaging Het
Ccdc85c C A 12: 108,274,658 R159L unknown Het
Clcn2 T C 16: 20,707,229 D797G probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Dclre1a A T 19: 56,544,306 F619I possibly damaging Het
Dnajb1 C A 8: 83,608,490 D53E probably benign Het
Dnmt1 T C 9: 20,941,543 D89G probably damaging Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gm597 T A 1: 28,776,659 D764V probably benign Het
Gm9507 A G 10: 77,811,816 S10P unknown Het
Hacd2 G A 16: 35,099,786 V138I probably benign Het
Hhip A T 8: 80,043,962 V272D probably damaging Het
Hoga1 A C 19: 42,059,908 T72P possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kif21b G A 1: 136,151,155 G414S probably damaging Het
Klk5 T A 7: 43,850,781 D264E probably benign Het
Lars G A 18: 42,243,877 R205C probably damaging Het
Ly6a A T 15: 74,997,570 L12Q probably null Het
Marc2 T A 1: 184,822,490 R273W probably null Het
Mastl A G 2: 23,118,437 *866Q probably null Het
Mpzl3 T A 9: 45,070,685 M217K possibly damaging Het
Mroh2b T A 15: 4,900,453 M7K probably benign Het
Nefh A G 11: 4,940,925 S565P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nsd1 C T 13: 55,313,546 L2632F Het
Olfr1022 A G 2: 85,864,179 probably benign Het
Olfr1143 T C 2: 87,802,580 Y60H probably damaging Het
Olfr1243 A T 2: 89,528,377 I11N possibly damaging Het
Olfr43 C T 11: 74,206,496 C240Y probably damaging Het
Olfr550 T C 7: 102,578,930 V145A probably benign Het
Olfr616 A T 7: 103,564,473 F269I possibly damaging Het
Olfr959 T A 9: 39,572,509 Y250F probably benign Het
Pcdhga6 T C 18: 37,708,340 V371A possibly damaging Het
Pdss2 A G 10: 43,393,949 K263E possibly damaging Het
Phf3 C T 1: 30,803,945 A1978T possibly damaging Het
Phykpl C A 11: 51,592,914 T207K probably benign Het
Pkd2 T A 5: 104,480,364 C435S probably damaging Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Prkra T A 2: 76,647,840 H6L probably benign Het
Prpf39 A G 12: 65,043,304 K131E probably damaging Het
Prpf40a A G 2: 53,145,243 V762A probably benign Het
Prr27 C T 5: 87,843,471 T314I probably damaging Het
Ptges3 A G 10: 128,072,129 D116G possibly damaging Het
Rab11fip5 G T 6: 85,340,693 F1071L probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Slc45a3 T C 1: 131,977,437 V66A possibly damaging Het
Ten1 A G 11: 116,205,736 Y72C probably damaging Het
Tenm3 A G 8: 48,292,151 L1125S probably damaging Het
Thpo T A 16: 20,725,807 I159F possibly damaging Het
Tmppe T C 9: 114,405,241 S203P probably damaging Het
Ttc23l A T 15: 10,537,575 I203N probably benign Het
Vars2 A G 17: 35,659,088 L803P possibly damaging Het
Vmn2r110 T A 17: 20,574,209 I733F Het
Xxylt1 T C 16: 31,080,927 N137D possibly damaging Het
Zc3h13 G A 14: 75,323,602 R544Q unknown Het
Zfhx4 C T 3: 5,412,138 T3271I probably benign Het
Zfp943 T A 17: 21,993,411 C493S possibly damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GACCCTGCTCTAGAGTTACATTTC -3'
(R):5'- TCACTTTTACAAAACCAAAGAGGGC -3'

Sequencing Primer
(F):5'- GCTCTAGAGTTACATTTCCGGAAAC -3'
(R):5'- AGCAGGGCGGGTGTGAATTATC -3'
Posted On 2021-12-30