Mutagenetix > Incidental Mutation

Incidental Mutation 'R9101:Aox2'

691664

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R9101 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58332637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 820 (P820L)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: P820L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: P820L

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	T	A	16: 14,049,395	I39N	probably damaging	Het
AA792892	G	A	5: 94,384,040	C261Y	probably damaging	Het
Adam6b	T	C	12: 113,491,756	V731A	probably benign	Het
Adamts7	T	C	9: 90,189,741		probably null	Het
Afdn	T	C	17: 13,823,444	V388A	probably damaging	Het
Alg3	A	G	16: 20,608,849	Y113H	possibly damaging	Het
Avil	A	G	10: 127,017,004	D731G	probably benign	Het
Blvra	C	T	2: 127,085,970	L47F	probably damaging	Het
Ccdc85c	C	A	12: 108,274,658	R159L	unknown	Het
Clcn2	T	C	16: 20,707,229	D797G	probably benign	Het
Cmklr1	G	C	5: 113,613,982	H319Q	probably benign	Het
Dclre1a	A	T	19: 56,544,306	F619I	possibly damaging	Het
Dnajb1	C	A	8: 83,608,490	D53E	probably benign	Het
Dnmt1	T	C	9: 20,941,543	D89G	probably damaging	Het
Gck	A	G	11: 5,906,516	Y214H	probably damaging	Het
Gm597	T	A	1: 28,776,659	D764V	probably benign	Het
Gm9507	A	G	10: 77,811,816	S10P	unknown	Het
Hacd2	G	A	16: 35,099,786	V138I	probably benign	Het
Hhip	A	T	8: 80,043,962	V272D	probably damaging	Het
Hoga1	A	C	19: 42,059,908	T72P	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Kif21b	G	A	1: 136,151,155	G414S	probably damaging	Het
Klk5	T	A	7: 43,850,781	D264E	probably benign	Het
Lars	G	A	18: 42,243,877	R205C	probably damaging	Het
Ly6a	A	T	15: 74,997,570	L12Q	probably null	Het
Marc2	T	A	1: 184,822,490	R273W	probably null	Het
Mastl	A	G	2: 23,118,437	*866Q	probably null	Het
Mpzl3	T	A	9: 45,070,685	M217K	possibly damaging	Het
Mroh2b	T	A	15: 4,900,453	M7K	probably benign	Het
Nefh	A	G	11: 4,940,925	S565P	probably damaging	Het
Nox4	G	A	7: 87,376,240	R525Q	probably benign	Het
Nsd1	C	T	13: 55,313,546	L2632F		Het
Olfr1022	A	G	2: 85,864,179		probably benign	Het
Olfr1143	T	C	2: 87,802,580	Y60H	probably damaging	Het
Olfr1243	A	T	2: 89,528,377	I11N	possibly damaging	Het
Olfr43	C	T	11: 74,206,496	C240Y	probably damaging	Het
Olfr550	T	C	7: 102,578,930	V145A	probably benign	Het
Olfr616	A	T	7: 103,564,473	F269I	possibly damaging	Het
Olfr959	T	A	9: 39,572,509	Y250F	probably benign	Het
Pcdhga6	T	C	18: 37,708,340	V371A	possibly damaging	Het
Pdss2	A	G	10: 43,393,949	K263E	possibly damaging	Het
Phf3	C	T	1: 30,803,945	A1978T	possibly damaging	Het
Phykpl	C	A	11: 51,592,914	T207K	probably benign	Het
Pkd2	T	A	5: 104,480,364	C435S	probably damaging	Het
Pramef6	T	A	4: 143,897,076	N176I	probably benign	Het
Prkra	T	A	2: 76,647,840	H6L	probably benign	Het
Prpf39	A	G	12: 65,043,304	K131E	probably damaging	Het
Prpf40a	A	G	2: 53,145,243	V762A	probably benign	Het
Prr27	C	T	5: 87,843,471	T314I	probably damaging	Het
Ptges3	A	G	10: 128,072,129	D116G	possibly damaging	Het
Rab11fip5	G	T	6: 85,340,693	F1071L	probably benign	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Het
Slc45a3	T	C	1: 131,977,437	V66A	possibly damaging	Het
Ten1	A	G	11: 116,205,736	Y72C	probably damaging	Het
Tenm3	A	G	8: 48,292,151	L1125S	probably damaging	Het
Thpo	T	A	16: 20,725,807	I159F	possibly damaging	Het
Tmppe	T	C	9: 114,405,241	S203P	probably damaging	Het
Ttc23l	A	T	15: 10,537,575	I203N	probably benign	Het
Vars2	A	G	17: 35,659,088	L803P	possibly damaging	Het
Vmn2r110	T	A	17: 20,574,209	I733F		Het
Xxylt1	T	C	16: 31,080,927	N137D	possibly damaging	Het
Zc3h13	G	A	14: 75,323,602	R544Q	unknown	Het
Zfhx4	C	T	3: 5,412,138	T3271I	probably benign	Het
Zfp943	T	A	17: 21,993,411	C493S	possibly damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GACCCTGCTCTAGAGTTACATTTC -3'
(R):5'- TCACTTTTACAAAACCAAAGAGGGC -3'

Sequencing Primer
(F):5'- GCTCTAGAGTTACATTTCCGGAAAC -3'
(R):5'- AGCAGGGCGGGTGTGAATTATC -3'

Posted On

2021-12-30