Incidental Mutation 'R5048:Aox1'
ID394439
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 042638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5048 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 58059482 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably benign
Transcript: ENSMUST00000001027
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.1%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,308,506 I144V probably benign Het
Abhd5 T C 9: 122,377,903 Y85H probably damaging Het
Acadsb G A 7: 131,437,469 G323D probably damaging Het
Amotl2 A G 9: 102,723,798 R322G probably benign Het
Aste1 C T 9: 105,396,989 R82W probably damaging Het
Atg4b T C 1: 93,775,658 I139T possibly damaging Het
Btnl5-ps T A 17: 34,488,723 noncoding transcript Het
Ccdc85c A G 12: 108,221,707 probably null Het
Clasp1 A G 1: 118,547,610 probably benign Het
Defb10 G A 8: 21,861,871 C44Y probably damaging Het
Dhrs9 T C 2: 69,394,400 V144A probably damaging Het
Dnhd1 G C 7: 105,693,697 S1416T probably benign Het
Dok1 T A 6: 83,032,106 probably benign Het
Emilin2 G A 17: 71,273,967 T588M probably damaging Het
Fam181b A G 7: 93,079,939 probably benign Het
Fhad1 T C 4: 141,964,676 probably null Het
Foxi2 A G 7: 135,411,635 E198G probably damaging Het
Fsip2 C A 2: 82,993,150 A6409E probably damaging Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gm38394 T C 1: 133,658,724 S292G probably damaging Het
Gm6401 T C 14: 41,967,767 probably null Het
Gprc5c T C 11: 114,870,351 *442Q probably null Het
Iars T A 13: 49,688,237 I67N probably damaging Het
Igkv4-79 T C 6: 69,042,987 S115G probably benign Het
Itga4 C A 2: 79,273,034 S156R probably benign Het
Lilra6 C T 7: 3,915,441 probably null Het
Majin C A 19: 6,222,654 A208E probably benign Het
Megf8 A G 7: 25,331,092 Q490R possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgarp G A 3: 51,391,286 R88C probably damaging Het
Msh2 T C 17: 87,672,768 F58S probably damaging Het
Nemp1 T C 10: 127,690,935 probably null Het
Nlrp10 A T 7: 108,924,565 N569K probably benign Het
Nxpe2 T C 9: 48,326,088 probably null Het
Olfr1140 C A 2: 87,746,319 A41E probably benign Het
Olfr1204 T C 2: 88,852,463 V171A possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pigb T A 9: 73,029,708 probably null Het
Pitpnb T C 5: 111,383,003 F221L possibly damaging Het
Prox2 A T 12: 85,094,341 W363R probably damaging Het
Psmg1 T A 16: 95,983,971 R139S probably benign Het
Rab11fip3 A G 17: 26,067,580 probably null Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Shkbp1 G A 7: 27,352,096 probably benign Het
Slc30a5 C A 13: 100,806,741 L536F probably damaging Het
Slc6a17 A T 3: 107,471,437 L643* probably null Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stoml3 A C 3: 53,500,792 K86N possibly damaging Het
Tmtc1 A T 6: 148,237,846 L926Q possibly damaging Het
Tns4 T G 11: 99,078,779 R285S possibly damaging Het
Uncx C T 5: 139,547,119 T313M probably benign Het
Vmn2r75 G A 7: 86,165,527 R253C possibly damaging Het
Zfp143 A G 7: 110,074,118 T142A probably damaging Het
Zfp287 T C 11: 62,714,951 K366E probably damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGGACTTAAAGCCGCATC -3'
(R):5'- TCAGGTCTCAAGGTCAAATCC -3'

Sequencing Primer
(F):5'- CAGGACTTAAAGCCGCATCTTAGTTC -3'
(R):5'- CAGGTCTCAAGGTCAAATCCTTTGG -3'
Posted On2016-06-15