Mutagenetix > Incidental Mutation

Incidental Mutation 'R4249:Aox2'

320515

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

041065-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4249 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58299819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 324 (S324G)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: S324G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: S324G

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,472,956	N36S	possibly damaging	Het
2810474O19Rik	T	A	6: 149,325,543	M29K	possibly damaging	Het
Ankrd39	A	G	1: 36,547,155	S11P	probably benign	Het
Atl3	T	C	19: 7,532,338	V477A	probably benign	Het
Bcar1	T	C	8: 111,720,893	T151A	probably benign	Het
Cdc42bpg	A	G	19: 6,315,266	T718A	possibly damaging	Het
Col9a1	C	T	1: 24,244,381	R843C	probably damaging	Het
Dnah12	T	A	14: 26,709,186	D316E	possibly damaging	Het
Fat2	A	G	11: 55,284,301	V1862A	probably damaging	Het
Fbxw5	C	A	2: 25,503,460	N233K	probably damaging	Het
Fcer2a	A	G	8: 3,688,831	F75L	probably benign	Het
Fhod3	A	G	18: 24,990,066	K271R	probably null	Het
Gimd1	T	C	3: 132,644,408	V144A	possibly damaging	Het
Glt1d1	T	C	5: 127,691,112		probably null	Het
Hecw2	C	T	1: 53,832,645	V1381M	probably damaging	Het
Kansl1l	C	T	1: 66,773,478	D459N	probably damaging	Het
Lmtk3	G	A	7: 45,794,062	C723Y	possibly damaging	Het
Muc4	T	C	16: 32,755,826		probably benign	Het
Myom1	T	A	17: 71,092,140	V999E	probably damaging	Het
Nckap5	A	G	1: 126,027,639	L460P	probably benign	Het
Olfr109	T	C	17: 37,466,824	M206T	probably damaging	Het
Phf13	A	T	4: 151,992,095	N213K	probably damaging	Het
Phldb3	T	C	7: 24,627,320	I591T	probably damaging	Het
Pik3cb	T	C	9: 99,101,176		probably null	Het
Pkd1l1	C	T	11: 8,865,543	R1456K	possibly damaging	Het
Plekhh2	A	G	17: 84,586,337	E860G	possibly damaging	Het
Rest	A	G	5: 77,282,112	T793A	probably benign	Het
Ropn1	C	T	16: 34,678,456	Q205*	probably null	Het
Sacs	A	C	14: 61,203,457	K984T	probably benign	Het
Samd11	G	A	4: 156,250,486	R102C	probably damaging	Het
Satl1	A	G	X: 112,406,336	S141P	probably benign	Het
Shank1	C	A	7: 44,319,736	H352N	unknown	Het
Slc22a27	A	T	19: 7,925,879	I162K	possibly damaging	Het
Snx8	A	G	5: 140,356,045	L121P	probably damaging	Het
Sumf1	A	C	6: 108,155,013	V156G	probably damaging	Het
Tln1	A	T	4: 43,536,104	V2027E	probably damaging	Het
Trdn	A	G	10: 33,450,998	I594M	probably benign	Het
Trim5	C	G	7: 104,276,815	E180Q	possibly damaging	Het
Tsen2	A	G	6: 115,547,824		probably benign	Het
Tubb1	A	T	2: 174,455,733	E45V	probably null	Het
Vmn2r67	T	A	7: 85,150,514		probably null	Het
Zcchc14	CTGATGGTGGTGGTGATGGTGGTGG	CTGATGGTGGTGG	8: 121,604,292		probably benign	Het
Zfp160	T	A	17: 21,025,738	F183L	probably benign	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- AGTCCCCAGAGACTGATCTAGC -3'
(R):5'- CTGATCTGTCGTTTCAACTCATTGAG -3'

Sequencing Primer
(F):5'- ATCTAGCTGACATGGGAGCTC -3'
(R):5'- CAACTCATTGAGACCTTTTGGC -3'

Posted On

2015-06-12