Incidental Mutation 'R6073:Aox1'
ID482560
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 58104509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably null
Transcript: ENSMUST00000001027
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAATGATTCTGGCTCTTTTGCC -3'
(R):5'- GGCTCCAAGACTGGGAATATC -3'

Posted On2017-07-14