Mutagenetix > Incidental Mutation

Incidental Mutation 'R8458:Lats1'

655130

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

067835-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R8458 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 7710924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 950 (L950*)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably null
Transcript: ENSMUST00000040043
AA Change: L950*

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: L950*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165952
AA Change: L950*

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: L950*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000217931
AA Change: L950*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	T	A	15: 94,353,640	H422L	probably benign	Het
Adgra3	G	T	5: 49,987,671	P527T	probably damaging	Het
Afg1l	A	G	10: 42,426,521	V161A	probably damaging	Het
Als2cl	A	C	9: 110,884,957	E65A	probably damaging	Het
Arl3	A	C	19: 46,558,270	S39A	probably benign	Het
Cacna1a	T	C	8: 84,549,458	V560A	probably damaging	Het
Ccr10	C	T	11: 101,174,156	G183R	probably damaging	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Chkb	A	T	15: 89,428,173	V213E	possibly damaging	Het
Chst5	A	G	8: 111,890,790	V66A	probably damaging	Het
Crx	C	A	7: 15,868,106	A216S	possibly damaging	Het
Ctnnd1	T	C	2: 84,613,943	D556G	probably damaging	Het
Cyp4a14	C	A	4: 115,495,932	G61V	probably damaging	Het
Cyp4f17	T	A	17: 32,520,576	F157L	probably damaging	Het
Dnah12	A	T	14: 26,826,892		probably null	Het
Dnah14	A	C	1: 181,806,012	H4P		Het
Dnah7a	T	C	1: 53,617,983	D878G	probably benign	Het
Epb41l1	C	T	2: 156,521,764	T731I	probably benign	Het
Epg5	G	C	18: 77,948,731	E214D	probably benign	Het
Fam171b	A	G	2: 83,860,520	T276A	probably benign	Het
Fat4	G	A	3: 38,981,553	R3118H	probably benign	Het
Fbrs	C	T	7: 127,483,157	R327W	probably damaging	Het
Fmo3	A	G	1: 162,966,940	V187A	possibly damaging	Het
Gins1	T	C	2: 150,930,887	V190A	probably benign	Het
Gm17067	T	C	7: 42,708,731	S116G	probably damaging	Het
Gm5478	A	G	15: 101,645,427	V250A	probably benign	Het
Gpr85	T	C	6: 13,836,849	T19A	probably benign	Het
Hepacam2	T	C	6: 3,483,358	N217S	probably damaging	Het
Igf1r	T	C	7: 68,195,629	Y889H	probably benign	Het
Itpr2	T	G	6: 146,233,966	R1822S	possibly damaging	Het
Kcnk7	C	T	19: 5,704,379		probably benign	Het
Klk1	T	C	7: 44,225,509	S11P	probably damaging	Het
Klra7	C	T	6: 130,224,146	G216R	probably damaging	Het
Krt34	T	C	11: 100,040,075	D167G	probably damaging	Het
Larp1b	A	C	3: 40,976,560	E291D	probably benign	Het
Lrrc2	A	C	9: 110,970,150	D255A	probably damaging	Het
Lrrc49	A	T	9: 60,598,173	M605K	probably benign	Het
Mocos	A	G	18: 24,666,257	K183E	probably benign	Het
Mpl	C	A	4: 118,444,016		probably null	Het
Mroh9	T	A	1: 163,055,681	T410S	probably damaging	Het
Notch3	T	C	17: 32,156,050	E430G	probably damaging	Het
Nsun6	T	C	2: 15,030,052	T252A	probably benign	Het
Ntrk1	C	A	3: 87,791,669		probably null	Het
Nts	G	T	10: 102,485,060	T56N	probably damaging	Het
Nup210l	A	G	3: 90,185,567	D1276G	probably null	Het
Olfr1255	G	T	2: 89,817,150	V269F	probably damaging	Het
Olfr1458	T	C	19: 13,102,476	Y276C	probably damaging	Het
Olfr642	C	A	7: 104,049,668	A229S	possibly damaging	Het
Osbpl8	A	G	10: 111,277,316	S535G	possibly damaging	Het
Pax9	A	G	12: 56,696,765	I66V	possibly damaging	Het
Pja2	A	G	17: 64,292,848	V547A	probably damaging	Het
Plekhs1	T	C	19: 56,477,158	L185S	probably benign	Het
Prkdc	T	A	16: 15,790,676		probably null	Het
Ptgdr2	A	T	19: 10,940,421	T101S	possibly damaging	Het
Ptprd	T	C	4: 76,066,259	D550G	probably benign	Het
Ptx3	G	T	3: 66,220,998	R160L	probably benign	Het
Rdh16f1	A	C	10: 127,788,845	E184A	probably damaging	Het
Rfx3	C	T	19: 27,793,672	E560K	possibly damaging	Het
Scgb2b24	T	C	7: 33,737,354	Q111R	probably benign	Het
Spg20	A	G	3: 55,124,894	D383G	probably damaging	Het
Stpg3	C	A	2: 25,213,321	R252L	probably damaging	Het
Tcp11l2	C	T	10: 84,613,532	Q454*	probably null	Het
Trav10d	A	G	14: 52,811,323	Y57C	probably damaging	Het
Vmn1r170	T	A	7: 23,606,896	M241K	possibly damaging	Het
Vwa8	T	A	14: 79,064,892	N1000K	probably damaging	Het
Wdsub1	T	C	2: 59,861,701	E329G	probably benign	Het
Wnk4	C	A	11: 101,275,321	C891*	probably null	Het
Zdhhc16	G	T	19: 41,939,654	C204F	probably damaging	Het
Zfp868	T	C	8: 69,611,908	I259V	possibly damaging	Het
Zranb3	G	T	1: 127,992,910	Q426K	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCCAACCTTACTTTAGAATATACC -3'
(R):5'- GGCTGGCTAACATATACAATGATGTC -3'

Sequencing Primer
(F):5'- CTAATGTCTGTATTCTGAGCAT -3'
(R):5'- CAAGTTTGAAGCCAACTGGTC -3'

Posted On

2020-10-20