Mutagenetix > Incidental Mutation

Incidental Mutation 'R8248:Lats1'

640381

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R8248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7705903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 817 (S817R)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: S817R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: S817R

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: S817R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: S817R

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930003A15Rik	T	C	16: 19,883,806	D24G	noncoding transcript	Het
Adam32	A	G	8: 24,901,470	S343P	possibly damaging	Het
Agbl2	G	A	2: 90,797,564	G238R	probably damaging	Het
Ahi1	T	A	10: 20,972,092	D466E	probably benign	Het
Ahnak	T	A	19: 9,001,946	V198E	probably damaging	Het
Ank2	T	A	3: 126,937,785	H658L	possibly damaging	Het
Atp8b5	T	A	4: 43,366,072	I781N	probably damaging	Het
Bloc1s6	A	T	2: 122,742,645	R47*	probably null	Het
Clk2	G	A	3: 89,173,504	V266M	probably damaging	Het
Cul9	A	C	17: 46,530,014	Y777D	probably damaging	Het
Dcp1a	C	T	14: 30,479,598		probably benign	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dnajb2	T	G	1: 75,243,582	D248E		Het
Dpy19l1	T	C	9: 24,502,895	H79R	probably benign	Het
Elmo1	T	C	13: 20,600,201	S643P	probably damaging	Het
Evi5	A	G	5: 107,818,887		probably null	Het
Fam76b	T	C	9: 13,831,102	C110R	probably damaging	Het
Galnt7	T	A	8: 57,538,188	K429N	probably benign	Het
Gm10142	T	A	10: 77,716,116	C104S	probably damaging	Het
Gm7298	A	C	6: 121,787,443	H1427P	probably benign	Het
Golga7b	A	T	19: 42,266,871	I87F	probably damaging	Het
Gpr165	C	A	X: 96,714,017	D7E	probably benign	Het
Gpr25	C	A	1: 136,260,677	R66L	probably benign	Het
H2-Q2	A	G	17: 35,344,865	N241D	probably benign	Het
Il1a	T	C	2: 129,302,961	D179G	probably benign	Het
Itch	T	C	2: 155,206,383		probably null	Het
Itsn2	T	C	12: 4,662,052	V913A	probably benign	Het
Kdm1b	T	A	13: 47,071,878		probably benign	Het
Lama4	T	C	10: 39,061,379	I655T	possibly damaging	Het
Lrrc8c	A	T	5: 105,607,867	M503L	probably benign	Het
Mast4	T	C	13: 102,738,721	T1380A	probably damaging	Het
Mfap1a	G	T	2: 121,506,495	T16K	possibly damaging	Het
Mroh2b	C	T	15: 4,931,104	T773I	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nudt7	A	G	8: 114,151,997	Y255C	probably benign	Het
Pfas	T	C	11: 69,000,263	T310A	probably damaging	Het
Pkhd1l1	T	G	15: 44,543,546	I2393R	probably damaging	Het
Pmm1	A	C	15: 81,960,731	L24R	possibly damaging	Het
Pram1	T	C	17: 33,641,164	V235A	probably benign	Het
Prg4	T	C	1: 150,455,126	T599A	unknown	Het
Prpf40b	A	G	15: 99,316,285	K812E	unknown	Het
Qars	G	A	9: 108,509,452	A155T	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rgs6	A	G	12: 83,137,704		probably benign	Het
Rom1	T	A	19: 8,928,681	R165W	probably damaging	Het
Rps6kb2	T	A	19: 4,156,988		probably benign	Het
Ryr1	A	T	7: 29,069,121	W2808R	probably damaging	Het
Sh3gl1	A	G	17: 56,019,038		probably null	Het
Slc22a30	A	T	19: 8,370,199	M279K	probably benign	Het
Snx11	A	G	11: 96,769,933	S184P	unknown	Het
Srgap1	A	G	10: 121,804,817	C692R	probably damaging	Het
Srgap3	T	C	6: 112,723,143	N982S	probably damaging	Het
Stac	T	A	9: 111,593,745	D270V	probably benign	Het
Syn3	T	A	10: 86,135,021	I246F	probably benign	Het
Tnr	T	C	1: 159,892,093	V980A	probably damaging	Het
Usp17le	G	T	7: 104,769,794	A47E	possibly damaging	Het
Vmn2r118	T	C	17: 55,610,936	N192S	probably benign	Het
Zmym4	C	A	4: 126,905,369	V725L	possibly damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTAGCAGAAGCCGACAATG -3'
(R):5'- GGTCTCATTCAGTGTTGAAGC -3'

Sequencing Primer
(F):5'- CGACAATGAGTGGGTGGTCC -3'
(R):5'- GAAGCCACTGTAAATTGTACTGC -3'

Posted On

2020-07-28