Mutagenetix > Incidental Mutation

Incidental Mutation 'R7644:Dmxl1'

590463

Institutional Source

Beutler Lab

Gene Symbol

Dmxl1

Ensembl Gene

ENSMUSG00000037416

Gene Name

Dmx-like 1

Synonyms

C630007L23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7644 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49832670-49965473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 49893552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1909 (V1909G)

Ref Sequence

ENSEMBL: ENSMUSP00000137871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041772
AA Change: V1909G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: V1909G

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
Pfam:Rav1p_C	1102	1877	4.3e-84	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2371	2385	N/A	INTRINSIC
low complexity region	2397	2410	N/A	INTRINSIC
low complexity region	2449	2466	N/A	INTRINSIC
WD40	2735	2770	1.07e1	SMART
WD40	2773	2813	3.7e0	SMART
WD40	2825	2867	1.07e0	SMART
WD40	2873	2912	1.05e-2	SMART
WD40	2915	2954	4.51e-7	SMART
Blast:WD40	2957	3005	9e-26	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000180611
AA Change: V1909G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: V1909G

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
low complexity region	1195	1206	N/A	INTRINSIC
low complexity region	1258	1271	N/A	INTRINSIC
Pfam:Rav1p_C	1287	1876	9.4e-72	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2385	2398	N/A	INTRINSIC
low complexity region	2437	2454	N/A	INTRINSIC
WD40	2723	2758	1.07e1	SMART
WD40	2761	2801	3.7e0	SMART
WD40	2813	2855	1.07e0	SMART
WD40	2861	2900	1.05e-2	SMART
WD40	2903	2942	4.51e-7	SMART
Blast:WD40	2945	2993	9e-26	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	C	T	2: 30,797,954	R209Q	possibly damaging	Het
2410089E03Rik	T	A	15: 8,223,127	D1944E	probably benign	Het
Abl2	A	G	1: 156,615,993	D24G	probably benign	Het
Adar	C	T	3: 89,745,519	A754V	probably benign	Het
Adcy8	C	T	15: 64,699,369	V1172I	possibly damaging	Het
Adgrl2	C	T	3: 148,839,153	V769M	probably damaging	Het
Akna	T	A	4: 63,395,397	Q163L	possibly damaging	Het
Alox15	C	T	11: 70,345,542	A511T	probably null	Het
Ano8	C	T	8: 71,484,830	G90D	probably damaging	Het
Aqp5	G	A	15: 99,594,226	R235H	probably damaging	Het
B3galt4	A	T	17: 33,950,445	V273E	probably damaging	Het
Ccdc125	C	T	13: 100,678,376		probably null	Het
Ccdc90b	A	G	7: 92,567,660	R47G	possibly damaging	Het
Celsr2	G	T	3: 108,413,490	L669I	probably damaging	Het
Clasp1	T	G	1: 118,512,750		probably null	Het
Clec4a2	C	T	6: 123,125,015	P43L	probably benign	Het
Cntn1	T	C	15: 92,310,009	I827T	probably benign	Het
Col9a1	G	T	1: 24,185,162	V142F	unknown	Het
Cts7	G	T	13: 61,356,968	Y23*	probably null	Het
Dcdc2a	T	A	13: 25,107,691	Y220N	probably damaging	Het
Ehd2	G	A	7: 15,957,549	P286L	possibly damaging	Het
Elf3	G	T	1: 135,256,506	A208E	possibly damaging	Het
Eml5	A	G	12: 98,855,944	I775T	probably benign	Het
Ephb1	T	C	9: 101,936,194	T791A	probably damaging	Het
Fanci	C	A	7: 79,444,471	S1105*	probably null	Het
Fastkd1	T	A	2: 69,696,840		probably null	Het
Fat4	A	G	3: 39,010,241	E4782G	possibly damaging	Het
Fnta	T	C	8: 26,013,488	I90V	probably damaging	Het
Fosl1	C	T	19: 5,450,304	R84*	probably null	Het
Gdf2	T	C	14: 33,944,890	F190L	probably benign	Het
Gzmn	T	A	14: 56,167,319	Q88L	probably damaging	Het
Hat1	T	A	2: 71,410,181	L73Q	probably damaging	Het
Hdhd2	G	A	18: 76,944,175	G109E	possibly damaging	Het
Il22ra1	A	G	4: 135,733,035	N34S	probably damaging	Het
Ino80d	T	C	1: 63,058,771	T760A	probably benign	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kdm6b	T	C	11: 69,400,206	N1574S	unknown	Het
Kel	T	C	6: 41,690,808	E400G	probably benign	Het
Kif22	G	A	7: 127,032,962	T350I	probably damaging	Het
Kif26b	A	G	1: 178,679,274	N305S	probably benign	Het
Klk12	A	C	7: 43,769,710	Q33P	probably damaging	Het
Klk1b24	G	A	7: 44,191,880		probably null	Het
Krtap31-1	T	A	11: 99,908,222	C84S	possibly damaging	Het
Ky	T	A	9: 102,537,773	S295T	probably benign	Het
Lpin3	T	A	2: 160,896,770	M214K	probably benign	Het
Mak	T	A	13: 41,030,110	N565Y	probably benign	Het
Mphosph6	T	C	8: 117,801,884	T7A	probably benign	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Myh11	T	C	16: 14,221,824	T814A		Het
Nmbr	T	C	10: 14,760,689	L134P	probably damaging	Het
Nup107	C	T	10: 117,770,470	V456M	probably damaging	Het
Olfr504	A	G	7: 108,565,442	S118P	possibly damaging	Het
Olfr936	C	A	9: 39,047,342	D26Y	probably damaging	Het
Pink1	A	T	4: 138,317,372	H351Q	probably damaging	Het
Piwil4	A	T	9: 14,734,415		probably null	Het
Pkd1l1	C	A	11: 8,875,758	V1498F		Het
Polb	A	G	8: 22,640,427	I161T	probably benign	Het
Polg	A	T	7: 79,451,668	L1097Q	probably damaging	Het
Prelp	T	C	1: 133,914,618	N263S	probably benign	Het
Pten	T	C	19: 32,811,834	C211R	probably damaging	Het
Ptprc	G	A	1: 138,067,907	A1012V	probably benign	Het
Ptprr	T	A	10: 116,048,228	H63Q	probably benign	Het
Rapsn	A	T	2: 91,041,954	H211L	possibly damaging	Het
Reln	T	C	5: 21,978,931	N1690S	probably benign	Het
Rpap2	A	G	5: 107,620,301	E335G	probably benign	Het
Rspry1	T	A	8: 94,658,768	S567T	probably benign	Het
Sf3b1	G	A	1: 54,997,143	R924*	probably null	Het
Sftpb	G	A	6: 72,309,835	E241K	probably benign	Het
Smarca4	G	T	9: 21,655,654	A677S	probably benign	Het
Srrm2	G	A	17: 23,819,320	R1646Q	unknown	Het
St5	A	T	7: 109,556,793	L250*	probably null	Het
Tex15	T	A	8: 33,574,417	C1292S	probably benign	Het
Tmem140	A	G	6: 34,872,773	I75V	probably benign	Het
Trhr2	T	A	8: 122,357,322	Q313L	possibly damaging	Het
Trim35	A	G	14: 66,297,097	T10A	unknown	Het
Ttn	T	C	2: 76,919,780	I3642V	probably benign	Het
Ugt1a2	T	C	1: 88,200,785	L50P	probably damaging	Het
Unc13a	C	A	8: 71,634,538	V1522L	probably benign	Het
Usp33	A	G	3: 152,357,952	D21G	possibly damaging	Het
Vmn1r90	G	A	7: 14,561,691	Q161*	probably null	Het
Vmn2r117	A	T	17: 23,477,291	W381R	probably damaging	Het
Vmn2r16	G	C	5: 109,339,971	A237P	probably damaging	Het
Vmn2r74	A	G	7: 85,957,538	V200A	probably benign	Het
Yjefn3	C	T	8: 69,887,894	V227M	probably damaging	Het
Zfp652	T	C	11: 95,750,088	F280L	probably damaging	Het
Zfp748	G	A	13: 67,541,449	T564I	probably damaging	Het

Other mutations in Dmxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Dmxl1	APN	18	49851467	missense	probably damaging	1.00
IGL00668:Dmxl1	APN	18	49939553	missense	possibly damaging	0.64
IGL00740:Dmxl1	APN	18	49917668	missense	probably benign	0.00
IGL00969:Dmxl1	APN	18	49912725	missense	probably benign	0.02
IGL01113:Dmxl1	APN	18	49912751	missense	probably benign	0.01
IGL01384:Dmxl1	APN	18	49857334	missense	probably benign
IGL01475:Dmxl1	APN	18	49871714	missense	probably damaging	1.00
IGL01559:Dmxl1	APN	18	49920938	missense	probably damaging	0.99
IGL01578:Dmxl1	APN	18	49962205	missense	probably damaging	1.00
IGL01632:Dmxl1	APN	18	49863025	missense	probably damaging	0.99
IGL01814:Dmxl1	APN	18	49864868	missense	probably damaging	1.00
IGL01843:Dmxl1	APN	18	49878382	nonsense	probably null
IGL01933:Dmxl1	APN	18	49877785	missense	probably benign	0.17
IGL01952:Dmxl1	APN	18	49890654	missense	probably benign	0.11
IGL02120:Dmxl1	APN	18	49894178	missense	possibly damaging	0.83
IGL02162:Dmxl1	APN	18	49961163	missense	probably benign	0.00
IGL02213:Dmxl1	APN	18	49877674	splice site	probably benign
IGL02261:Dmxl1	APN	18	49840499	missense	possibly damaging	0.85
IGL02689:Dmxl1	APN	18	49864895	missense	probably damaging	1.00
IGL02892:Dmxl1	APN	18	49859120	missense	probably damaging	0.96
IGL03232:Dmxl1	APN	18	49878180	missense	probably benign	0.01
IGL03258:Dmxl1	APN	18	49920893	missense	probably damaging	1.00
IGL03298:Dmxl1	APN	18	49864818	missense	probably benign
capture	UTSW	18	49962261	missense	probably damaging	1.00
carnivora	UTSW	18	49864383	missense	probably damaging	0.99
digestion	UTSW	18	49878259	missense	probably damaging	1.00
drowning	UTSW	18	49878225	missense	possibly damaging	0.55
hibiscus	UTSW	18	49889467	missense	probably damaging	1.00
impound	UTSW	18	49893249	missense	probably benign
pitcher	UTSW	18	49864148	missense	probably damaging	1.00
PIT4810001:Dmxl1	UTSW	18	49931963	missense	probably damaging	1.00
R0001:Dmxl1	UTSW	18	49888897	splice site	probably benign
R0027:Dmxl1	UTSW	18	49957295	splice site	probably benign
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0257:Dmxl1	UTSW	18	49955803	splice site	probably benign
R0349:Dmxl1	UTSW	18	49879282	missense	probably damaging	0.99
R0390:Dmxl1	UTSW	18	49879362	missense	probably benign	0.14
R0511:Dmxl1	UTSW	18	49891467	nonsense	probably null
R0539:Dmxl1	UTSW	18	49857430	splice site	probably benign
R0542:Dmxl1	UTSW	18	49893694	missense	probably benign	0.05
R0587:Dmxl1	UTSW	18	49935307	missense	probably benign	0.39
R0635:Dmxl1	UTSW	18	49851423	splice site	probably benign
R0744:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0836:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0845:Dmxl1	UTSW	18	49893402	missense	probably damaging	1.00
R1218:Dmxl1	UTSW	18	49893611	missense	probably damaging	1.00
R1278:Dmxl1	UTSW	18	49893225	missense	probably benign
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1349:Dmxl1	UTSW	18	49888853	missense	probably damaging	1.00
R1453:Dmxl1	UTSW	18	49857249	missense	probably benign	0.05
R1522:Dmxl1	UTSW	18	49852367	missense	probably benign	0.05
R1629:Dmxl1	UTSW	18	49859286	critical splice donor site	probably null
R1638:Dmxl1	UTSW	18	49890767	nonsense	probably null
R1646:Dmxl1	UTSW	18	49962261	missense	probably damaging	1.00
R1719:Dmxl1	UTSW	18	49934637	missense	probably damaging	1.00
R1732:Dmxl1	UTSW	18	49893444	nonsense	probably null
R1732:Dmxl1	UTSW	18	49902988	missense	probably benign
R1886:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1887:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1895:Dmxl1	UTSW	18	49955914	splice site	probably null
R1911:Dmxl1	UTSW	18	49878163	missense	probably benign	0.00
R2020:Dmxl1	UTSW	18	49889558	nonsense	probably null
R2116:Dmxl1	UTSW	18	49878817	missense	probably damaging	1.00
R2196:Dmxl1	UTSW	18	49917631	missense	probably benign	0.00
R2206:Dmxl1	UTSW	18	49894094	missense	probably benign	0.12
R2216:Dmxl1	UTSW	18	49893923	missense	probably benign	0.00
R2255:Dmxl1	UTSW	18	49846639	missense	probably benign	0.34
R2333:Dmxl1	UTSW	18	49919976	splice site	probably null
R2343:Dmxl1	UTSW	18	49890678	missense	probably damaging	1.00
R2496:Dmxl1	UTSW	18	49880791	missense	possibly damaging	0.51
R3757:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3758:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3783:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3786:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3787:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3885:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3886:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3887:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3888:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3889:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R4014:Dmxl1	UTSW	18	49863962	missense	probably benign
R4033:Dmxl1	UTSW	18	49851431	missense	possibly damaging	0.95
R4096:Dmxl1	UTSW	18	49961197	missense	probably damaging	1.00
R4366:Dmxl1	UTSW	18	49878017	nonsense	probably null
R4406:Dmxl1	UTSW	18	49889553	missense	probably damaging	1.00
R4412:Dmxl1	UTSW	18	49848761	missense	probably benign
R4454:Dmxl1	UTSW	18	49893332	missense	probably benign	0.01
R4459:Dmxl1	UTSW	18	49961216	missense	possibly damaging	0.80
R4569:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4570:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4606:Dmxl1	UTSW	18	49962181	missense	probably damaging	0.98
R4649:Dmxl1	UTSW	18	49878631	missense	probably damaging	0.99
R4683:Dmxl1	UTSW	18	49878021	missense	probably damaging	1.00
R4782:Dmxl1	UTSW	18	49862992	missense	probably damaging	1.00
R4878:Dmxl1	UTSW	18	49851476	missense	probably damaging	1.00
R4879:Dmxl1	UTSW	18	49889467	missense	probably damaging	1.00
R4881:Dmxl1	UTSW	18	49957281	intron	probably benign
R4885:Dmxl1	UTSW	18	49878795	missense	probably damaging	0.99
R4916:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5022:Dmxl1	UTSW	18	49895127	missense	probably damaging	0.99
R5056:Dmxl1	UTSW	18	49870923	missense	probably benign	0.00
R5177:Dmxl1	UTSW	18	49893584	missense	probably damaging	0.99
R5342:Dmxl1	UTSW	18	49951235	missense	probably damaging	0.96
R5421:Dmxl1	UTSW	18	49863119	critical splice donor site	probably null
R5433:Dmxl1	UTSW	18	49867899	splice site	probably null
R5484:Dmxl1	UTSW	18	49889464	missense	probably damaging	1.00
R5598:Dmxl1	UTSW	18	49864478	missense	probably benign	0.04
R5633:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5638:Dmxl1	UTSW	18	49891626	missense	possibly damaging	0.95
R5694:Dmxl1	UTSW	18	49894257	missense	probably damaging	1.00
R5696:Dmxl1	UTSW	18	49931941	nonsense	probably null
R5706:Dmxl1	UTSW	18	49957395	critical splice donor site	probably null
R5745:Dmxl1	UTSW	18	49846586	missense	probably benign
R5876:Dmxl1	UTSW	18	49870984	missense	possibly damaging	0.70
R6054:Dmxl1	UTSW	18	49857386	missense	probably benign	0.00
R6145:Dmxl1	UTSW	18	49912766	missense	possibly damaging	0.90
R6189:Dmxl1	UTSW	18	49893335	missense	probably benign	0.33
R6213:Dmxl1	UTSW	18	49863015	missense	possibly damaging	0.93
R6219:Dmxl1	UTSW	18	49902367	missense	probably damaging	0.99
R6221:Dmxl1	UTSW	18	49871732	missense	probably damaging	0.96
R6276:Dmxl1	UTSW	18	49846586	missense	probably benign
R6319:Dmxl1	UTSW	18	49852300	missense	probably benign	0.00
R6426:Dmxl1	UTSW	18	49864578	missense	probably damaging	0.99
R6567:Dmxl1	UTSW	18	49859179	missense	probably damaging	0.99
R6739:Dmxl1	UTSW	18	49878246	missense	probably benign	0.03
R6743:Dmxl1	UTSW	18	49880780	missense	possibly damaging	0.95
R6776:Dmxl1	UTSW	18	49893974	missense	probably damaging	1.00
R6827:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6828:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6829:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6830:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6833:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6834:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6856:Dmxl1	UTSW	18	49852288	nonsense	probably null
R6857:Dmxl1	UTSW	18	49864835	missense	probably damaging	0.99
R6881:Dmxl1	UTSW	18	49935305	missense	probably benign	0.00
R6882:Dmxl1	UTSW	18	49843784	critical splice acceptor site	probably null
R6892:Dmxl1	UTSW	18	49920902	missense	probably damaging	0.98
R6897:Dmxl1	UTSW	18	49851495	missense	probably null	0.99
R6897:Dmxl1	UTSW	18	49863057	missense	possibly damaging	0.51
R6917:Dmxl1	UTSW	18	49864148	missense	probably damaging	1.00
R7192:Dmxl1	UTSW	18	49955853	missense	probably damaging	0.99
R7447:Dmxl1	UTSW	18	49864614	missense	probably damaging	0.99
R7460:Dmxl1	UTSW	18	49878612	missense	probably benign	0.00
R7570:Dmxl1	UTSW	18	49893957	missense	possibly damaging	0.82
R7626:Dmxl1	UTSW	18	49902794	missense	probably benign
R7629:Dmxl1	UTSW	18	49859270	missense	probably damaging	1.00
R7688:Dmxl1	UTSW	18	49955871	missense	probably benign	0.03
R7689:Dmxl1	UTSW	18	49846618	missense	probably benign	0.00
R7712:Dmxl1	UTSW	18	49893461	missense	probably damaging	0.99
R7808:Dmxl1	UTSW	18	49878315	missense	probably benign	0.00
R7834:Dmxl1	UTSW	18	49920977	missense	probably damaging	1.00
R7848:Dmxl1	UTSW	18	49840490	missense	possibly damaging	0.88
R7849:Dmxl1	UTSW	18	49961147	missense	probably benign	0.00
R7881:Dmxl1	UTSW	18	49864383	missense	probably damaging	0.99
R7884:Dmxl1	UTSW	18	49893407	missense	possibly damaging	0.65
R8073:Dmxl1	UTSW	18	49878433	missense	probably damaging	1.00
R8089:Dmxl1	UTSW	18	49888830	missense	probably damaging	0.99
R8266:Dmxl1	UTSW	18	49843811	missense	probably benign	0.17
R8371:Dmxl1	UTSW	18	49898714	missense	probably benign	0.08
R8402:Dmxl1	UTSW	18	49878326	nonsense	probably null
R8402:Dmxl1	UTSW	18	49878327	missense	probably benign	0.09
R8402:Dmxl1	UTSW	18	49878342	missense	probably benign
R8423:Dmxl1	UTSW	18	49865116	missense	probably damaging	1.00
R8678:Dmxl1	UTSW	18	49871692	nonsense	probably null
R8702:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R8749:Dmxl1	UTSW	18	49955870	missense	probably damaging	1.00
R8813:Dmxl1	UTSW	18	49957339	missense	probably damaging	0.99
R8877:Dmxl1	UTSW	18	49878225	missense	possibly damaging	0.55
R8945:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R8971:Dmxl1	UTSW	18	49864508	missense	possibly damaging	0.96
R8971:Dmxl1	UTSW	18	49893674	missense	probably damaging	1.00
R8978:Dmxl1	UTSW	18	49922612	missense	probably benign	0.37
R8987:Dmxl1	UTSW	18	49893852	missense
R9011:Dmxl1	UTSW	18	49864173	missense	probably damaging	1.00
R9124:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9131:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9132:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9156:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9165:Dmxl1	UTSW	18	49878925	missense	probably damaging	1.00
R9244:Dmxl1	UTSW	18	49893249	missense	probably benign
R9254:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.67
R9262:Dmxl1	UTSW	18	49843852	missense	probably benign	0.03
R9335:Dmxl1	UTSW	18	49859120	missense	probably damaging	0.96
R9375:Dmxl1	UTSW	18	49958410	missense	probably damaging	1.00
R9379:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.67
R9434:Dmxl1	UTSW	18	49877721	missense	probably damaging	0.98
R9470:Dmxl1	UTSW	18	49893710	missense	possibly damaging	0.69
R9500:Dmxl1	UTSW	18	49878204	missense	probably damaging	1.00
R9507:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.94
R9617:Dmxl1	UTSW	18	49865161	missense	probably damaging	1.00
R9642:Dmxl1	UTSW	18	49880758	missense	probably damaging	1.00
RF009:Dmxl1	UTSW	18	49893394	missense	probably damaging	0.96
X0025:Dmxl1	UTSW	18	49864368	missense	probably damaging	0.98
X0066:Dmxl1	UTSW	18	49919899	missense	probably damaging	1.00
Z1088:Dmxl1	UTSW	18	49920965	missense	probably benign
Z1188:Dmxl1	UTSW	18	49868003	missense	probably damaging	0.96
Z1189:Dmxl1	UTSW	18	49868003	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTGGCAGGAACAATTAATCTAAGTG -3'
(R):5'- AACTGTCTTTCTCTGCAAAGGTC -3'

Sequencing Primer
(F):5'- CTGCCCAATGTTGGCTTT -3'
(R):5'- CTTTCATTGAAATAGGGGGATCTTC -3'

Posted On

2019-10-24