Incidental Mutation 'R7988:Gstm7'
ID651578
Institutional Source Beutler Lab
Gene Symbol Gstm7
Ensembl Gene ENSMUSG00000004035
Gene Nameglutathione S-transferase, mu 7
SynonymsCd203c, 0610005A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107926334-107931817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107926955 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000004137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004137] [ENSMUST00000106687] [ENSMUST00000106688] [ENSMUST00000124215] [ENSMUST00000133947]
PDB Structure Crystal structure of mouse glutathione S-transferase, mu7 (GSTM7) at 1.6 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004137
AA Change: M198K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004137
Gene: ENSMUSG00000004035
AA Change: M198K

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.2e-23 PFAM
Pfam:GST_C_3 42 190 1.2e-9 PFAM
Pfam:GST_C 104 191 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106687
AA Change: M161K

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102298
Gene: ENSMUSG00000004035
AA Change: M161K

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.8e-24 PFAM
Pfam:GST_N_3 11 93 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106688
AA Change: M194K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102299
Gene: ENSMUSG00000004035
AA Change: M194K

DomainStartEndE-ValueType
Pfam:GST_N_3 4 89 8.8e-7 PFAM
Pfam:GST_N 5 78 4.2e-19 PFAM
Pfam:GST_C 100 188 5.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124215
SMART Domains Protein: ENSMUSP00000118707
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 1 72 8.6e-20 PFAM
Pfam:GST_N_3 3 83 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133947
SMART Domains Protein: ENSMUSP00000122567
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GST_N 45 123 2.6e-19 PFAM
Pfam:GST_N_3 54 134 1.4e-6 PFAM
Meta Mutation Damage Score 0.8531 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Gstm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Gstm7 APN 3 107930278 missense possibly damaging 0.93
PIT4142001:Gstm7 UTSW 3 107931483 frame shift probably null
R0095:Gstm7 UTSW 3 107930563 splice site probably benign
R0961:Gstm7 UTSW 3 107926986 unclassified probably benign
R1052:Gstm7 UTSW 3 107926950 missense probably benign 0.05
R2121:Gstm7 UTSW 3 107926914 missense probably benign 0.00
R4610:Gstm7 UTSW 3 107926919 missense possibly damaging 0.65
R5966:Gstm7 UTSW 3 107931431 intron probably benign
R6393:Gstm7 UTSW 3 107930826 critical splice donor site probably null
R7014:Gstm7 UTSW 3 107926962 missense probably benign 0.00
R7052:Gstm7 UTSW 3 107931317 missense probably damaging 0.96
R7741:Gstm7 UTSW 3 107931647 missense possibly damaging 0.90
R7848:Gstm7 UTSW 3 107928586 splice site probably null
R7998:Gstm7 UTSW 3 107930341 missense probably damaging 1.00
R8952:Gstm7 UTSW 3 107931441 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGCTTGGGATCTGGAAC -3'
(R):5'- ATCTATAATGGGCACGATCCC -3'

Sequencing Primer
(F):5'- AGGAAAGAAGAAGGAAAAGTTGGCTG -3'
(R):5'- ACGATCCCGATGCACAGG -3'
Posted On2020-09-15