Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Cemip'

651591

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

C to A at 84003408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

AlphaFold

Q8BI06

Predicted Effect

probably benign
Transcript: ENSMUST00000064174

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
R8496:Cemip	UTSW	7	83951426	missense	probably benign	0.00
R8698:Cemip	UTSW	7	83958582	missense	probably damaging	0.98
R8835:Cemip	UTSW	7	83937443	missense	probably damaging	1.00
R9229:Cemip	UTSW	7	83957625	missense	probably damaging	1.00
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGATGAGGCTTGCCAGAATC -3'
(R):5'- TGGCCCTGACTCATAGTAGG -3'

Sequencing Primer
(F):5'- TGCCAGAATCCAAGGTGTTC -3'
(R):5'- CCCTGACTCATAGTAGGTGAGG -3'

Posted On

2020-09-15