Mutagenetix > Incidental Mutations

Incidental Mutation 'R8448:Ints2'

654618

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8448 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86255423 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 120 (T120A)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T120A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T120A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132024
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068
AA Change: T120A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	140	1e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136469

SMART Domains

Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	98	6.5e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139285
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: T120A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,285,144	L18Q	probably damaging	Het
4933430I17Rik	T	C	4: 62,542,785		probably null	Het
Adamts6	T	A	13: 104,479,519	C1030S	probably damaging	Het
Adamtsl3	C	A	7: 82,603,799	T1527K	possibly damaging	Het
Akap9	G	A	5: 3,948,897		probably null	Het
Ankle2	C	A	5: 110,242,043	P457T	possibly damaging	Het
Ankrd7	A	G	6: 18,868,008	N91S	probably damaging	Het
Ascc3	C	A	10: 50,618,077	Q203K	probably benign	Het
Baz2b	A	T	2: 59,911,793	D61E		Het
Bmpr1a	T	A	14: 34,414,802	K477N	probably benign	Het
Cacna1d	T	C	14: 30,102,407	I1040V	probably damaging	Het
Cdkn2a	C	A	4: 89,282,054	V20L	possibly damaging	Het
Chd5	A	G	4: 152,360,716	S385G	probably damaging	Het
Cntrob	A	G	11: 69,299,853	F46L	unknown	Het
Cth	T	C	3: 157,925,020	D4G	probably benign	Het
Cyld	C	T	8: 88,729,569	H416Y	probably damaging	Het
Dennd6a	C	A	14: 26,606,943	H264Q	possibly damaging	Het
Dnah1	T	C	14: 31,293,725	Y1672C	probably damaging	Het
Dnah8	A	G	17: 30,673,840	I800V	probably benign	Het
Esrp2	A	G	8: 106,132,221	Y595H	probably damaging	Het
F12	T	A	13: 55,418,488	Y497F	probably benign	Het
Fggy	A	G	4: 95,844,190	T473A	probably benign	Het
Gatsl2	T	C	5: 134,138,116	F304L	possibly damaging	Het
Gm884	T	A	11: 103,620,900	T81S	unknown	Het
Gstt2	C	A	10: 75,832,692	R107L	probably damaging	Het
Hectd4	A	T	5: 121,220,256		probably benign	Het
Helb	A	G	10: 120,102,886	F561S	probably damaging	Het
Kdm5d	G	A	Y: 914,056	R331H	probably benign	Het
Krt6b	A	G	15: 101,678,020	Y345H	probably damaging	Het
Limch1	A	G	5: 67,002,482	K418E	probably damaging	Het
Med17	C	T	9: 15,262,439		probably null	Het
Met	A	T	6: 17,571,800	I1373F	probably benign	Het
Naip6	T	A	13: 100,300,386	Q543L	possibly damaging	Het
Nat9	T	C	11: 115,185,076	T40A	probably damaging	Het
Notch4	A	T	17: 34,586,789		probably null	Het
Ogdh	A	G	11: 6,342,619	N455S	probably damaging	Het
Olfr552	C	A	7: 102,605,000	F215L	probably benign	Het
Pde4a	T	C	9: 21,206,238	F599L	probably benign	Het
Pga5	T	C	19: 10,671,809	Y249C	probably damaging	Het
Plekha8	A	T	6: 54,630,554	K382M	probably damaging	Het
Plekhd1	A	T	12: 80,706,375	E119V	probably damaging	Het
Pnp	A	T	14: 50,947,899	H20L	probably benign	Het
Polq	A	T	16: 37,017,197		probably null	Het
Psma3	T	G	12: 70,988,476	I177R	probably damaging	Het
Ptpn3	A	G	4: 57,240,784		probably null	Het
Ptprt	A	T	2: 161,558,886	L1077Q	probably damaging	Het
Ralgps2	A	T	1: 156,824,174		probably null	Het
Rbm47	A	T	5: 66,027,230	M10K	possibly damaging	Het
Rere	A	G	4: 150,619,196	D186G	probably damaging	Het
Rpl24	T	C	16: 55,967,090	S38P	probably damaging	Het
Slco1a1	A	T	6: 141,940,061	F79L	possibly damaging	Het
Sorl1	T	A	9: 41,991,745	D1551V	probably benign	Het
Sos1	C	A	17: 80,434,119	M412I	probably benign	Het
Spast	G	A	17: 74,359,298	V209I	probably benign	Het
Spindoc	G	T	19: 7,358,404	Q340K	possibly damaging	Het
Tlr6	T	C	5: 64,953,842	Y574C	probably damaging	Het
Tnrc6a	A	G	7: 123,192,123	N1748S	possibly damaging	Het
Trbv13-2	A	T	6: 41,121,540	K16N	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Usp24	A	G	4: 106,368,736	D659G	possibly damaging	Het
Vmn2r88	T	A	14: 51,418,796	C821S	probably damaging	Het
Whamm	T	A	7: 81,574,547	V197D	probably damaging	Het
Zfp777	A	G	6: 48,029,167	F431S	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACATGTAACCTGCCTGCC -3'
(R):5'- ACAGTGTTTCGGAGGAATGG -3'

Sequencing Primer
(F):5'- GTAAGTACACTGTAGCTGTCCTCAG -3'
(R):5'- TGGAAACCATTTACAATGAGTGG -3'

Posted On

2020-10-20