Incidental Mutation 'IGL02837:Pik3c2g'
ID391911
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #IGL02837 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 139626564 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 249 (C249*)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect probably null
Transcript: ENSMUST00000032353
AA Change: C249*
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: C249*

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000185968
AA Change: C249*
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: C249*

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186585
Predicted Effect probably null
Transcript: ENSMUST00000187618
AA Change: C249*
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: C249*

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188066
Predicted Effect probably null
Transcript: ENSMUST00000190962
AA Change: C249*
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: C249*

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGATGCATACATTCCTGAAG -3'
(R):5'- AGCCAGCAAGGTGATCAATG -3'

Sequencing Primer
(F):5'- TGCATACATTCCTGAAGACTAAAATC -3'
(R):5'- CCAGCAAGGTGATCAATGATAGCTTG -3'
Posted On2016-06-08