Incidental Mutation 'R5580:Pik3c2g'
ID438385
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 043134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5580 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139626533 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 239 (Q239L)
Ref Sequence ENSEMBL: ENSMUSP00000140368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032353
AA Change: Q239L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: Q239L

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: Q239L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: Q239L

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186585
Predicted Effect possibly damaging
Transcript: ENSMUST00000187618
AA Change: Q239L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: Q239L

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188066
Predicted Effect possibly damaging
Transcript: ENSMUST00000190962
AA Change: Q239L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: Q239L

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,256 D583E probably benign Het
2410002F23Rik A G 7: 44,251,240 T73A possibly damaging Het
A1bg A T 15: 60,919,032 V365E probably benign Het
Abcg5 A C 17: 84,660,154 V406G probably damaging Het
Adamts12 A G 15: 11,152,000 Y192C probably benign Het
Add3 C T 19: 53,245,211 S649L probably damaging Het
Adgrg6 A T 10: 14,410,484 C1129* probably null Het
Arsb T A 13: 93,807,545 V248D probably damaging Het
AW554918 A T 18: 25,339,865 N39I probably damaging Het
Cacna1b A T 2: 24,650,554 I1383N probably damaging Het
Caprin2 A T 6: 148,858,734 V625D possibly damaging Het
Cd9 A G 6: 125,464,457 L67P probably damaging Het
Cdh5 T A 8: 104,125,494 Y80* probably null Het
Csf2ra A G 19: 61,226,217 L223P probably damaging Het
Cyp2c67 T C 19: 39,615,650 K421E probably damaging Het
Dzank1 T C 2: 144,506,178 R223G probably damaging Het
Emilin2 A G 17: 71,275,230 V167A probably benign Het
Eps8l3 A G 3: 107,881,603 T81A probably damaging Het
Esrra T C 19: 6,920,387 M1V probably null Het
Evpl C A 11: 116,234,232 A135S probably benign Het
Fam193a A G 5: 34,420,788 I209V probably benign Het
Fbxl19 C A 7: 127,750,996 C253* probably null Het
Fer1l5 T A 1: 36,385,458 Y305* probably null Het
Fzd2 A C 11: 102,605,839 I370L probably damaging Het
Gm8882 T C 6: 132,361,469 N262S unknown Het
Gnl3 T C 14: 31,015,285 K212R probably benign Het
Golm1 A G 13: 59,642,365 L207P probably benign Het
Gphn T A 12: 78,492,044 F155I probably damaging Het
Grhl1 G A 12: 24,609,740 G500S probably benign Het
Gucd1 C A 10: 75,511,134 G55V possibly damaging Het
Haus6 A T 4: 86,599,266 I287K possibly damaging Het
Hmcn1 G A 1: 150,577,539 P5342S probably benign Het
Hspa12a A G 19: 58,799,660 S577P probably benign Het
Ido2 T A 8: 24,550,866 I113F possibly damaging Het
Ifrd2 C T 9: 107,592,312 P396S probably damaging Het
Igkv4-86 T A 6: 68,911,006 probably benign Het
Ipo11 A G 13: 106,900,747 V196A probably benign Het
Itih2 T C 2: 10,123,476 E138G probably damaging Het
Kidins220 T G 12: 25,047,897 C1179G probably benign Het
Kif20b T A 19: 34,949,728 probably null Het
Klk1 T A 7: 44,228,814 Y63N probably benign Het
L3mbtl3 T G 10: 26,303,706 D517A unknown Het
Lars G T 18: 42,214,851 P969H probably damaging Het
Lrp1 C T 10: 127,588,520 V766I probably benign Het
Lrrc8c A G 5: 105,607,687 I443V probably benign Het
Lsg1 T C 16: 30,569,167 M439V probably null Het
Magi2 T A 5: 20,215,424 M286K probably benign Het
Med11 T C 11: 70,452,065 probably null Het
Med13l A G 5: 118,751,630 K1819E possibly damaging Het
Ms4a14 T A 19: 11,303,226 Q656L probably benign Het
Muc5b A G 7: 141,861,347 T2677A possibly damaging Het
Myo7a A T 7: 98,073,160 L1186H probably damaging Het
Naca C A 10: 128,040,593 probably benign Het
Nbeal1 T C 1: 60,242,602 I828T probably benign Het
Ncor1 A T 11: 62,389,778 C75* probably null Het
Nepn A C 10: 52,404,302 S497R probably damaging Het
Nf2 A G 11: 4,803,689 F222L probably damaging Het
Nlrp9b A C 7: 20,023,164 T109P probably damaging Het
Nr1h4 A T 10: 89,516,440 F22I probably benign Het
Ogg1 A G 6: 113,329,376 Y178C probably damaging Het
Olfr1162 A T 2: 88,050,324 M100K possibly damaging Het
Olfr1271 C A 2: 90,266,350 V27L probably benign Het
Olfr1444 G A 19: 12,861,804 V10M possibly damaging Het
Olfr1475 T A 19: 13,479,427 Y257F probably damaging Het
Olfr381 G T 11: 73,486,210 P205T probably benign Het
Osr1 G A 12: 9,579,325 R66Q probably damaging Het
Pi4ka A G 16: 17,281,087 S1978P probably damaging Het
Pin1rt1 A G 2: 104,714,325 I154T probably damaging Het
Pkdcc A G 17: 83,220,082 T230A probably damaging Het
Por A T 5: 135,733,821 I430F probably damaging Het
Prkcsh T A 9: 22,011,255 probably null Het
Pros1 A G 16: 62,926,326 probably null Het
Pus10 T A 11: 23,672,556 L59I probably benign Het
Pxmp2 A G 5: 110,283,676 V67A possibly damaging Het
Rab3gap1 C A 1: 127,930,990 A612E probably benign Het
Rpap2 A G 5: 107,620,145 E206G probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Ryr3 C T 2: 112,841,948 G1393R probably damaging Het
Scara5 T C 14: 65,731,079 M267T probably benign Het
Sema5a A T 15: 32,574,885 I380F probably benign Het
Slc36a3 A G 11: 55,135,453 S180P probably benign Het
Slc44a5 A G 3: 154,261,285 K536R probably benign Het
Smg1 T C 7: 118,148,902 probably benign Het
Strc T C 2: 121,375,012 K879R probably damaging Het
Swt1 T C 1: 151,384,455 E731G probably benign Het
Syngap1 G A 17: 26,962,331 A9T probably damaging Het
Tex15 C T 8: 33,572,429 T903I probably damaging Het
Tg A G 15: 66,685,300 I937V possibly damaging Het
Tm9sf4 T C 2: 153,182,430 Y58H probably damaging Het
Tsen2 A T 6: 115,577,980 D458V probably damaging Het
Ttn T A 2: 76,917,802 D4301V probably benign Het
Txk C A 5: 72,707,589 L314F probably damaging Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Ubn2 A G 6: 38,483,252 M641V probably damaging Het
Usp4 C T 9: 108,365,859 T242I probably benign Het
Usp53 A G 3: 122,934,234 S900P probably benign Het
Vmn1r225 T C 17: 20,502,839 Y181H probably damaging Het
Vmn1r83 T A 7: 12,321,873 I86L probably benign Het
Vmn2r65 T C 7: 84,947,594 I84M probably damaging Het
Vstm2b A G 7: 40,902,626 H126R probably damaging Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp975 A T 7: 42,665,089 L20* probably null Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGCATACATTCCTGAAGAC -3'
(R):5'- AGCCAGCAAGGTGATCAATG -3'

Sequencing Primer
(F):5'- TGCATACATTCCTGAAGACTAAAATC -3'
(R):5'- CCAGCAAGGTGATCAATGATAGCTTG -3'
Posted On2016-10-26