Incidental Mutation 'R8559:Vmn2r103'
ID660955
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8559 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19812384 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 807 (M807V)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: M807V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: M807V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T A 10: 89,732,186 H19L probably benign Het
Adamts9 A T 6: 92,807,136 V1579E probably benign Het
Arhgap40 C T 2: 158,541,801 R435C probably damaging Het
Atp1a4 T C 1: 172,251,330 D207G probably damaging Het
Btaf1 A G 19: 36,986,873 N948S probably benign Het
Calcr G A 6: 3,692,603 P417L probably damaging Het
Cep250 T A 2: 155,992,736 S2194T probably damaging Het
Clcn6 C T 4: 148,026,575 V102M possibly damaging Het
Cog2 T C 8: 124,542,908 S396P probably benign Het
Col28a1 C A 6: 8,166,681 R265L unknown Het
Cpa6 C T 1: 10,408,349 W254* probably null Het
Crtc2 T A 3: 90,263,597 M659K possibly damaging Het
Ctgf CCCGCCAACCGC CCCGC 10: 24,596,068 probably null Het
Dnah7c A G 1: 46,725,139 Y3020C probably damaging Het
Dok2 C A 14: 70,777,528 H232N probably benign Het
Edem3 A G 1: 151,818,418 E834G probably benign Het
Elac2 T A 11: 64,981,676 probably null Het
Epx T A 11: 87,864,792 I689F probably damaging Het
Exd2 G A 12: 80,475,857 R30H probably benign Het
Gja1 T C 10: 56,388,208 L221P probably damaging Het
Gli3 T A 13: 15,660,132 L400Q probably damaging Het
Gm8439 T A 4: 120,600,811 W50R unknown Het
Greb1 T A 12: 16,696,435 D1278V probably damaging Het
Grin3a C A 4: 49,770,555 C739F probably damaging Het
Gucy2g C A 19: 55,210,354 V786F probably benign Het
Hmcn1 G A 1: 150,676,038 T2605I probably benign Het
Hmgxb3 T A 18: 61,155,419 T459S probably benign Het
Ift172 T C 5: 31,256,577 H1469R probably damaging Het
Il1rap A G 16: 26,712,134 I407V probably benign Het
Inppl1 G T 7: 101,829,627 S555* probably null Het
Krt8 T C 15: 102,001,544 M142V probably benign Het
Lrrk1 T A 7: 66,282,327 N1049I possibly damaging Het
Megf10 G A 18: 57,240,627 A166T probably damaging Het
Mei4 A T 9: 82,025,631 H338L probably benign Het
Mfsd2b T C 12: 4,871,471 T33A possibly damaging Het
Mgat3 A T 15: 80,212,169 Y399F probably damaging Het
Mtmr4 C T 11: 87,604,124 T414I probably damaging Het
Muc4 T C 16: 32,754,715 S1530P unknown Het
Myl4 T C 11: 104,584,104 V93A possibly damaging Het
N4bp2 T A 5: 65,825,285 S1627R possibly damaging Het
Narf T G 11: 121,250,432 probably null Het
Nbas A C 12: 13,352,808 I788L probably benign Het
Nlrc3 A G 16: 3,965,282 S104P probably benign Het
Olfr1047 A G 2: 86,228,644 V109A probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Olfr1240 T A 2: 89,440,184 I32F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Ppp4r4 A T 12: 103,593,161 T534S probably benign Het
Prg3 A G 2: 84,989,336 E58G probably benign Het
Prima1 A G 12: 103,197,253 V153A possibly damaging Het
Rp1 A T 1: 4,349,561 Y443N probably damaging Het
Rpgrip1 T C 14: 52,149,257 S882P unknown Het
Scn1a T A 2: 66,287,733 D412V probably damaging Het
Srcin1 T C 11: 97,537,149 T180A probably damaging Het
Suox A G 10: 128,670,731 L476P probably damaging Het
Tas2r104 T C 6: 131,685,425 Y107C probably damaging Het
Tubg2 T C 11: 101,156,784 V65A probably damaging Het
Ubn1 T C 16: 5,064,770 V365A possibly damaging Het
Vmn2r75 T A 7: 86,166,272 Y128F possibly damaging Het
Vps13b A T 15: 35,876,642 I2814F probably damaging Het
Vps54 T C 11: 21,264,815 Y108H probably damaging Het
Wdr6 T A 9: 108,575,394 E430V probably benign Het
Zfp619 T A 7: 39,537,135 V863E probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 19811943 missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGGATATCTCTGCTTCTTGGCC -3'
(R):5'- GAGCAGTTGAATCACCAGAGC -3'

Sequencing Primer
(F):5'- TGGCCCTTGGAAGTTACACCATG -3'
(R):5'- TTGAATCACCAGAGCAAACATGG -3'
Posted On2021-03-08