Incidental Mutation 'R8186:Vmn2r103'
ID634887
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8186 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19811943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 660 (T660S)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: T660S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: T660S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,286,631 T1921A probably damaging Het
Add2 G A 6: 86,108,020 V543M probably benign Het
Agl A G 3: 116,758,908 I459T possibly damaging Het
Atg16l2 C T 7: 101,296,507 probably null Het
BC048403 T A 10: 121,745,342 F83I possibly damaging Het
C130073F10Rik G A 4: 101,890,834 R48* probably null Het
Cdc25b C T 2: 131,189,130 T125M probably benign Het
Cdc42bpg T A 19: 6,306,865 F50L probably damaging Het
Chd9 T A 8: 90,998,605 D1187E unknown Het
Col4a2 T C 8: 11,425,542 probably null Het
Cped1 T C 6: 22,123,588 S447P probably benign Het
Ddx19a T A 8: 110,983,642 M109L probably benign Het
Def8 C A 8: 123,461,476 Y431* probably null Het
Dusp27 A G 1: 166,100,079 S655P probably damaging Het
Gata4 A G 14: 63,201,513 S373P probably benign Het
Gm8926 A G 5: 11,773,959 D158G probably damaging Het
Gm9837 A T 11: 53,470,309 L26* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hspa1b A T 17: 34,957,581 V476E probably damaging Het
Htr5b G A 1: 121,528,379 probably benign Het
Hydin T C 8: 110,609,645 V5018A probably benign Het
Ighv1-85 A G 12: 116,000,303 S26P probably benign Het
Lrrc2 A G 9: 110,960,842 K56E possibly damaging Het
Macf1 A T 4: 123,372,426 I6793N probably damaging Het
Macf1 A C 4: 123,382,130 V6215G possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,559,012 probably null Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Oprk1 A T 1: 5,602,317 M226L probably benign Het
Phf2 A G 13: 48,807,751 L821P unknown Het
Rdh7 C A 10: 127,887,415 probably null Het
Rpl11 A G 4: 136,051,657 V74A possibly damaging Het
Safb2 G A 17: 56,566,051 R790C possibly damaging Het
Sgpp2 T C 1: 78,416,972 F204S probably benign Het
Sgsm3 A C 15: 81,009,442 I426L possibly damaging Het
Tbccd1 A G 16: 22,818,439 L545P probably damaging Het
Toporsl T A 4: 52,610,489 F127L probably damaging Het
Ttc25 A G 11: 100,563,679 D430G probably benign Het
Ttn T G 2: 76,918,912 Q3931P probably damaging Het
Tuba1c C A 15: 99,037,515 L286I probably benign Het
Usp48 A G 4: 137,621,196 R528G possibly damaging Het
Utrn T C 10: 12,698,123 T1068A probably benign Het
Vmn2r105 G T 17: 20,224,618 Y537* probably null Het
Vmn2r88 A T 14: 51,418,700 I744F Het
Wnt9b T C 11: 103,730,775 E352G probably damaging Het
Zfp78 A G 7: 6,373,229 N46D probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 19812384 missense probably benign 0.01
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGGGGATGACTCTAGCCAG -3'
(R):5'- GAGAAGTTGTCATCCATATTCCAC -3'

Sequencing Primer
(F):5'- GATGACTCTAGCCAGCGTAG -3'
(R):5'- TTCCACAAATAAGAAGCTGGATCAG -3'
Posted On2020-07-13