Mutagenetix > Incidental Mutation

Incidental Mutation 'R4301:Son'

322431

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

041088-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91444712-91476080 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91455299 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1349 (T1349A)

Ref Sequence

ENSEMBL: ENSMUSP00000109671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114036
AA Change: T1349A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: T1349A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114037
AA Change: T1349A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: T1349A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117633
AA Change: T1349A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: T1349A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000119368
AA Change: T1349A

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: T1349A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140312
AA Change: T1349A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: T1349A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,377,266 (GRCm39)	V95D	probably damaging	Het
Adamtsl2	A	G	2: 26,977,295 (GRCm39)	D252G	probably null	Het
Adgra3	T	C	5: 50,118,420 (GRCm39)	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,417,237 (GRCm39)	D562G	probably damaging	Het
Ccdc70	T	C	8: 22,463,228 (GRCm39)	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,718,810 (GRCm39)	V337A	probably benign	Het
Chil4	G	A	3: 106,111,043 (GRCm39)	P284S	possibly damaging	Het
Crb1	A	G	1: 139,176,568 (GRCm39)	S472P	probably benign	Het
Fam193b	G	A	13: 55,690,417 (GRCm39)	R740*	probably null	Het
Fer	G	T	17: 64,385,905 (GRCm39)	L292F	probably damaging	Het
Gmppa	G	A	1: 75,419,140 (GRCm39)	R349H	possibly damaging	Het
Hspa1a	T	C	17: 35,189,482 (GRCm39)	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Lrrc30	A	G	17: 67,939,563 (GRCm39)	S6P	probably damaging	Het
Lzts3	A	G	2: 130,478,358 (GRCm39)	S133P	probably damaging	Het
Mrtfb	T	C	16: 13,216,169 (GRCm39)	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,106 (GRCm39)	F122I	possibly damaging	Het
Mypn	A	G	10: 62,954,263 (GRCm39)	Y124H	probably damaging	Het
Nfat5	T	C	8: 108,082,327 (GRCm39)		probably benign	Het
Npr2	T	C	4: 43,641,332 (GRCm39)		probably null	Het
Or5a3	T	C	19: 12,400,081 (GRCm39)	L136P	probably damaging	Het
Pgm2	G	A	5: 64,261,140 (GRCm39)	W51*	probably null	Het
Phip	G	A	9: 82,841,766 (GRCm39)	R48*	probably null	Het
Piezo2	T	C	18: 63,217,911 (GRCm39)	T1075A	probably damaging	Het
Ppat	G	T	5: 77,076,348 (GRCm39)		probably benign	Het
Ppp2r2b	T	A	18: 43,031,811 (GRCm39)	E23D	probably null	Het
Prickle1	T	C	15: 93,406,517 (GRCm39)	I169V	possibly damaging	Het
Rab37	T	A	11: 115,049,390 (GRCm39)	D95E	possibly damaging	Het
Sash1	A	G	10: 8,627,234 (GRCm39)	V50A	probably benign	Het
Siae	C	A	9: 37,545,009 (GRCm39)	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,292,676 (GRCm39)	I217K	probably damaging	Het
Sptb	A	G	12: 76,659,471 (GRCm39)	L1143S	probably damaging	Het
Trim80	T	C	11: 115,335,939 (GRCm39)		probably null	Het
Trpm3	T	C	19: 22,964,656 (GRCm39)	S1374P	probably benign	Het
Vldlr	C	A	19: 27,215,802 (GRCm39)	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 86,651,099 (GRCm39)	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,330,220 (GRCm39)	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,078,018 (GRCm39)		probably benign	Het
Zswim8	G	A	14: 20,763,977 (GRCm39)	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,779,861 (GRCm39)	V1878A	probably damaging	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91,461,210 (GRCm39)	missense	probably damaging	0.99
IGL01024:Son	APN	16	91,452,798 (GRCm39)	missense	probably damaging	1.00
IGL01066:Son	APN	16	91,457,024 (GRCm39)	intron	probably benign
IGL01083:Son	APN	16	91,454,279 (GRCm39)	missense	probably damaging	1.00
IGL01115:Son	APN	16	91,456,346 (GRCm39)	missense	probably benign	0.31
IGL01467:Son	APN	16	91,454,165 (GRCm39)	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91,454,174 (GRCm39)	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91,454,903 (GRCm39)	missense	probably benign	0.00
IGL02156:Son	APN	16	91,452,992 (GRCm39)	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91,455,683 (GRCm39)	missense	probably damaging	0.99
IGL02498:Son	APN	16	91,453,713 (GRCm39)	missense	probably damaging	0.99
IGL02517:Son	APN	16	91,452,099 (GRCm39)	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91,455,359 (GRCm39)	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91,448,640 (GRCm39)	missense	probably damaging	1.00
IGL03180:Son	APN	16	91,453,896 (GRCm39)	missense	probably damaging	1.00
R0013:Son	UTSW	16	91,448,550 (GRCm39)	missense	probably damaging	1.00
R0036:Son	UTSW	16	91,457,054 (GRCm39)	intron	probably benign
R0037:Son	UTSW	16	91,461,616 (GRCm39)	missense	probably damaging	1.00
R0041:Son	UTSW	16	91,456,221 (GRCm39)	missense	probably damaging	1.00
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91,475,043 (GRCm39)	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91,453,761 (GRCm39)	missense	probably damaging	0.99
R0256:Son	UTSW	16	91,453,472 (GRCm39)	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91,453,032 (GRCm39)	missense	probably damaging	1.00
R0815:Son	UTSW	16	91,452,372 (GRCm39)	missense	probably damaging	0.98
R1225:Son	UTSW	16	91,454,228 (GRCm39)	missense	probably damaging	1.00
R1255:Son	UTSW	16	91,461,583 (GRCm39)	missense	probably damaging	1.00
R1457:Son	UTSW	16	91,453,974 (GRCm39)	missense	probably damaging	1.00
R1459:Son	UTSW	16	91,452,230 (GRCm39)	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91,456,622 (GRCm39)	missense	probably damaging	0.99
R1587:Son	UTSW	16	91,456,606 (GRCm39)	missense	probably damaging	1.00
R1605:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R1629:Son	UTSW	16	91,454,510 (GRCm39)	missense	probably damaging	1.00
R1711:Son	UTSW	16	91,457,114 (GRCm39)	intron	probably benign
R2138:Son	UTSW	16	91,456,260 (GRCm39)	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91,444,848 (GRCm39)	splice site	probably null
R2351:Son	UTSW	16	91,454,547 (GRCm39)	missense	probably damaging	0.98
R2434:Son	UTSW	16	91,451,575 (GRCm39)	missense	probably damaging	1.00
R2870:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2871:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2872:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2889:Son	UTSW	16	91,456,787 (GRCm39)	unclassified	probably benign
R3712:Son	UTSW	16	91,453,614 (GRCm39)	missense	probably damaging	0.99
R3913:Son	UTSW	16	91,456,999 (GRCm39)	intron	probably benign
R4172:Son	UTSW	16	91,456,250 (GRCm39)	missense	probably damaging	1.00
R4302:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91,455,756 (GRCm39)	missense	probably damaging	0.96
R4881:Son	UTSW	16	91,472,397 (GRCm39)	missense	probably benign	0.31
R5020:Son	UTSW	16	91,453,263 (GRCm39)	missense	probably damaging	1.00
R5032:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R5151:Son	UTSW	16	91,452,587 (GRCm39)	missense	probably damaging	1.00
R5153:Son	UTSW	16	91,451,910 (GRCm39)	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91,453,563 (GRCm39)	missense	probably damaging	0.99
R5243:Son	UTSW	16	91,451,621 (GRCm39)	missense	probably damaging	1.00
R5354:Son	UTSW	16	91,452,627 (GRCm39)	missense	probably damaging	0.99
R5529:Son	UTSW	16	91,452,354 (GRCm39)	missense	probably damaging	1.00
R5696:Son	UTSW	16	91,468,301 (GRCm39)	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91,454,378 (GRCm39)	missense	probably damaging	1.00
R5766:Son	UTSW	16	91,461,875 (GRCm39)	intron	probably benign
R5788:Son	UTSW	16	91,456,940 (GRCm39)	intron	probably benign
R5992:Son	UTSW	16	91,455,792 (GRCm39)	missense	probably benign	0.04
R6314:Son	UTSW	16	91,457,298 (GRCm39)	intron	probably benign
R6371:Son	UTSW	16	91,471,629 (GRCm39)
R6429:Son	UTSW	16	91,455,054 (GRCm39)	missense	probably benign	0.33
R6451:Son	UTSW	16	91,454,490 (GRCm39)	missense	probably damaging	0.99
R6489:Son	UTSW	16	91,452,044 (GRCm39)	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91,456,835 (GRCm39)	intron	probably benign
R6753:Son	UTSW	16	91,454,076 (GRCm39)	missense	probably damaging	0.99
R6916:Son	UTSW	16	91,451,673 (GRCm39)	missense	probably damaging	0.97
R7070:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7079:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7110:Son	UTSW	16	91,453,406 (GRCm39)	missense	probably benign	0.01
R7120:Son	UTSW	16	91,467,414 (GRCm39)	missense	unknown
R7120:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7167:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7205:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7208:Son	UTSW	16	91,458,990 (GRCm39)	missense	unknown
R7219:Son	UTSW	16	91,461,889 (GRCm39)	missense	unknown
R7249:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7328:Son	UTSW	16	91,455,278 (GRCm39)	missense	probably benign	0.33
R7330:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7374:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7405:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7420:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7424:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7464:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7514:Son	UTSW	16	91,451,748 (GRCm39)	missense	probably damaging	0.99
R7555:Son	UTSW	16	91,455,810 (GRCm39)	missense	probably damaging	0.99
R7645:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7716:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7718:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7778:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7824:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7856:Son	UTSW	16	91,456,146 (GRCm39)	missense	probably damaging	0.99
R7870:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7928:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7978:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8000:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8192:Son	UTSW	16	91,452,437 (GRCm39)	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8227:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8233:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8255:Son	UTSW	16	91,461,824 (GRCm39)	missense	unknown
R8292:Son	UTSW	16	91,453,545 (GRCm39)	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8468:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8495:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R8772:Son	UTSW	16	91,454,826 (GRCm39)	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8862:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8962:Son	UTSW	16	91,455,057 (GRCm39)	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8991:Son	UTSW	16	91,453,608 (GRCm39)	missense	possibly damaging	0.95
R8991:Son	UTSW	16	91,453,366 (GRCm39)	missense	probably benign	0.04
R9086:Son	UTSW	16	91,467,418 (GRCm39)	missense	unknown
R9138:Son	UTSW	16	91,452,006 (GRCm39)	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9241:Son	UTSW	16	91,454,122 (GRCm39)	missense	probably damaging	0.96
R9258:Son	UTSW	16	91,474,570 (GRCm39)	missense	unknown
R9328:Son	UTSW	16	91,452,645 (GRCm39)	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91,454,508 (GRCm39)	missense	probably damaging	0.98
R9468:Son	UTSW	16	91,454,439 (GRCm39)	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9516:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9595:Son	UTSW	16	91,454,241 (GRCm39)	missense	possibly damaging	0.73
R9679:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9719:Son	UTSW	16	91,456,440 (GRCm39)	missense	probably damaging	0.96
R9749:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9772:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9782:Son	UTSW	16	91,444,838 (GRCm39)	missense	probably damaging	0.99
R9788:Son	UTSW	16	91,453,699 (GRCm39)	unclassified	probably benign
RF007:Son	UTSW	16	91,456,257 (GRCm39)	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
Z1176:Son	UTSW	16	91,452,689 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCCAGAGAGACCGATGACTTAC -3'
(R):5'- AGCAAAGTTCTGGAGTAGCC -3'

Sequencing Primer
(F):5'- GCCAGCTGTGTTAACATCAG -3'
(R):5'- TAGCCATGGTAGGAGGCTC -3'

Posted On

2015-06-20