Mutagenetix > Incidental Mutation

Incidental Mutation 'R6613:C4b'

523808

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34733565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1167 (S1167T)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: S1167T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: S1167T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173669

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.9%

Validation Efficiency

97% (37/38)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	G	A	6: 125,806,656		probably null	Het
Arfgef1	A	T	1: 10,194,396	I475N	possibly damaging	Het
Atg16l2	C	T	7: 101,290,581		probably null	Het
Atp2c2	T	G	8: 119,756,021	L874R	probably damaging	Het
C2cd3	T	A	7: 100,395,241	S343R	possibly damaging	Het
Cacna1i	G	A	15: 80,321,259	G139S	probably damaging	Het
Chil6	A	T	3: 106,389,875	F317I	probably benign	Het
Cngb1	A	T	8: 95,266,010	V199E	possibly damaging	Het
Dcn	A	T	10: 97,495,040	T79S	probably benign	Het
Dcxr	A	G	11: 120,727,006	V48A	probably benign	Het
Dnajc13	A	T	9: 104,213,877	D668E	probably benign	Het
Dnajc28	C	A	16: 91,616,358	E357*	probably null	Het
Dock7	A	G	4: 98,977,960	Y1198H	probably damaging	Het
Flot1	A	G	17: 35,825,811	D167G	probably damaging	Het
Gpn1	T	C	5: 31,497,352		probably null	Het
Hyou1	A	T	9: 44,382,498	I242F	probably damaging	Het
Igfbpl1	T	C	4: 45,813,447	N256S	probably benign	Het
Kif20b	C	T	19: 34,936,984	Q390*	probably null	Het
Lhfpl2	T	A	13: 94,174,495	F91Y	probably damaging	Het
Magi1	G	A	6: 93,745,673	T408I	probably damaging	Het
Mttp	T	C	3: 138,109,078	N479D	probably damaging	Het
Myom3	T	C	4: 135,812,459	V1339A	possibly damaging	Het
Nin	T	C	12: 70,030,954	K1733E	probably damaging	Het
Olfr173	C	A	16: 58,797,531	C105F	probably damaging	Het
Pdzrn4	T	C	15: 92,677,574	I287T	probably damaging	Het
Ptprt	A	G	2: 161,530,447	V1435A	probably damaging	Het
Rpap3	T	C	15: 97,681,841		probably null	Het
Scin	A	G	12: 40,079,715	Y360H	probably benign	Het
Sfxn5	A	G	6: 85,269,908		probably null	Het
Sgo1	A	G	17: 53,679,057	S369P	probably damaging	Het
Skil	T	A	3: 31,097,880	C184S	probably null	Het
Srcin1	A	G	11: 97,533,827	M607T	possibly damaging	Het
Ssc5d	C	T	7: 4,933,293	P513S	possibly damaging	Het
Trip10	A	G	17: 57,255,197		probably null	Het
Vmn2r114	T	A	17: 23,310,246	Q294L	possibly damaging	Het
Zc3h12c	A	G	9: 52,116,112	V650A	possibly damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTTTCAGGCAATCCGAGGG -3'
(R):5'- TCACAACTCTGGCCTGACAG -3'

Sequencing Primer
(F):5'- AAGTCCCAGGTGCTCTGC -3'
(R):5'- TCTGACGAGACAGTGGCAC -3'

Posted On

2018-06-22