Incidental Mutation 'R8725:C4b'
ID662389
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8725 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34734485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1008 (E1008G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: E1008G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: E1008G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,273,756 T1770A unknown Het
A630089N07Rik C T 16: 98,066,451 A104T probably damaging Het
Abhd18 T A 3: 40,930,192 L222Q probably damaging Het
Adam30 C T 3: 98,163,032 T727M possibly damaging Het
Adh6b A T 3: 138,352,968 Q137L probably damaging Het
Alpl C T 4: 137,747,816 V269I probably benign Het
Ang2 C T 14: 51,195,539 G129S probably benign Het
Atp6v0a1 A T 11: 101,029,189 H216L possibly damaging Het
BC030500 C T 8: 58,913,015 T61I unknown Het
Brpf1 T G 6: 113,316,530 L520R probably damaging Het
Btbd10 A G 7: 113,328,419 I243T possibly damaging Het
Bub1 C A 2: 127,804,219 C947F probably damaging Het
Ccdc40 A G 11: 119,264,497 T1188A probably benign Het
Cnn1 G T 9: 22,099,261 probably benign Het
Colgalt2 T C 1: 152,484,911 M233T probably damaging Het
Cox15 A T 19: 43,746,742 C195* probably null Het
Cped1 A T 6: 22,059,942 R202S possibly damaging Het
Dact2 A T 17: 14,196,884 C351* probably null Het
Dbnl A G 11: 5,788,582 N8S probably benign Het
Depdc1a T A 3: 159,522,719 N369K probably benign Het
Dnah2 A T 11: 69,524,179 L243Q probably damaging Het
Dscaml1 T A 9: 45,430,461 Y57N probably benign Het
Eif2b3 A G 4: 117,070,747 T388A probably benign Het
Eif4h A C 5: 134,625,539 probably null Het
Elf1 C T 14: 79,573,227 Q288* probably null Het
Fgl2 C T 5: 21,375,679 R340* probably null Het
Fut4 T C 9: 14,750,786 D404G probably damaging Het
Glmn G A 5: 107,570,286 P255L probably benign Het
Gm14322 C T 2: 177,769,688 T97I probably benign Het
Gm44511 C A 6: 128,821,034 C32F probably damaging Het
Gm5478 A G 15: 101,645,436 F247S probably damaging Het
Gm7534 T C 4: 134,202,839 K52E probably benign Het
Golgb1 T A 16: 36,919,201 M2675K probably damaging Het
Hectd1 T C 12: 51,802,217 D368G possibly damaging Het
Hnrnpul2 A G 19: 8,820,700 N140S probably benign Het
Htr4 A T 18: 62,428,138 I157L probably damaging Het
Kcnma1 T G 14: 23,386,264 M790L probably benign Het
Kcnv1 G A 15: 45,114,603 S13L unknown Het
Kctd20 C T 17: 28,965,051 R312* probably null Het
Kdm3b T A 18: 34,827,382 I1340N probably damaging Het
Kdm6b A G 11: 69,402,093 F1286L unknown Het
Knl1 T A 2: 119,069,043 F408L probably benign Het
Lypd5 G T 7: 24,353,676 G253W probably damaging Het
Mea1 A G 17: 46,681,688 T21A probably benign Het
Metrnl A G 11: 121,716,016 E299G possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nxpe2 A T 9: 48,326,773 F61I probably benign Het
Olfr786 T C 10: 129,437,465 Y218H probably benign Het
Olfr814 T A 10: 129,874,223 D178V probably damaging Het
Pgr C A 9: 8,901,543 P359Q probably damaging Het
Pi4k2b G A 5: 52,750,689 V157I probably benign Het
Plekhm1 A C 11: 103,367,618 F1031L probably damaging Het
Pltp A G 2: 164,854,381 S124P probably damaging Het
Polr3gl T A 3: 96,579,838 E177V probably benign Het
Pstk G T 7: 131,371,295 R41L possibly damaging Het
Rasgrp1 T C 2: 117,288,677 E493G probably benign Het
Rtn3 A G 19: 7,457,361 L422P probably benign Het
Rusc2 C T 4: 43,401,351 probably benign Het
Sbno2 A G 10: 80,075,256 F6S probably benign Het
Sh2d4a A G 8: 68,346,043 Y348C probably damaging Het
Sh3rf3 A G 10: 59,104,170 probably null Het
Sipa1l2 T C 8: 125,450,386 E1163G probably benign Het
Strip1 G C 3: 107,614,648 A738G probably damaging Het
Tdrkh C T 3: 94,425,992 R255C probably benign Het
Tln1 A T 4: 43,555,911 M101K possibly damaging Het
Trav6-2 A C 14: 52,667,571 probably benign Het
Tspan11 A T 6: 127,923,711 I82F possibly damaging Het
Ttn T C 2: 76,948,976 K1233E unknown Het
Usp29 A T 7: 6,962,918 S587C probably damaging Het
Vmn1r235 A T 17: 21,261,794 Q127L probably damaging Het
Vmn1r65 C A 7: 6,008,504 A244S probably damaging Het
Vmn2r18 A G 5: 151,584,997 S221P probably damaging Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACTCTCCAGCTGTTTGGGC -3'
(R):5'- TTCACCTGAAGTCCATGGACC -3'

Sequencing Primer
(F):5'- TTGGGCCAGGGCTGTACTC -3'
(R):5'- GAAGTCCATGGACCCTGTTATAGTC -3'
Posted On2021-03-08