Mutagenetix > Incidental Mutations

Incidental Mutation 'R4299:C4b'

323517

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

041087-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34731144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1384 (D1384G)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069507
AA Change: D1384G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D1384G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173669

Meta Mutation Damage Score

0.1128

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	A	G	5: 31,487,526	R208G	possibly damaging	Het
Abcc12	T	C	8: 86,531,525		probably null	Het
Akna	A	T	4: 63,398,032	D31E	possibly damaging	Het
Apbb2	A	T	5: 66,313,378	H528Q	probably damaging	Het
Atp6v1g3	C	A	1: 138,283,724	Y47*	probably null	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
BC048403	C	A	10: 121,745,446	H117Q	probably benign	Het
C87499	T	C	4: 88,628,182	K137E	probably damaging	Het
Cbfa2t2	G	A	2: 154,523,928	V353I	probably damaging	Het
Cdh7	T	C	1: 110,061,001	I211T	probably damaging	Het
Cep170b	T	C	12: 112,739,305	S1166P	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Crygs	G	A	16: 22,805,411	Q149*	probably null	Het
Cyp2c70	T	C	19: 40,183,928	Q90R	probably benign	Het
Cyp3a41b	T	C	5: 145,573,677	Y129C	possibly damaging	Het
Dnah10	A	G	5: 124,819,925	T3645A	probably damaging	Het
Dolk	A	T	2: 30,285,188	W282R	probably damaging	Het
Dsg2	T	A	18: 20,595,951		probably null	Het
Dysf	A	G	6: 84,068,077	T297A	possibly damaging	Het
Flt1	G	T	5: 147,683,907	D142E	probably benign	Het
Frmd4a	C	A	2: 4,333,071	N29K	probably benign	Het
Fxyd7	A	T	7: 31,044,982	M36K	probably benign	Het
Gabbr1	C	T	17: 37,055,900	R178*	probably null	Het
Gm14139	G	A	2: 150,190,733	D17N	probably damaging	Het
Gnal	C	G	18: 67,088,583	P19R	unknown	Het
Gprc5b	G	A	7: 118,984,214	A144V	possibly damaging	Het
Il1rapl1	A	T	X: 87,300,707	I194N	probably damaging	Het
Klhl24	T	C	16: 20,107,004	M94T	probably damaging	Het
Kmt2e	T	A	5: 23,464,914	I133N	probably damaging	Het
Macf1	A	G	4: 123,399,406	I5381T	probably damaging	Het
Madd	A	G	2: 91,169,803	L197P	probably damaging	Het
Mapkapk3	G	A	9: 107,257,449	T296M	probably damaging	Het
Micall2	T	C	5: 139,709,471		probably benign	Het
Myh9	T	C	15: 77,769,964	T1214A	probably benign	Het
Ncapd3	A	G	9: 27,052,327	N492S	probably benign	Het
Neurl4	A	C	11: 69,909,061	D1055A	probably damaging	Het
Nrbp1	T	C	5: 31,250,599		probably null	Het
Olfr1052	A	T	2: 86,298,241	I142F	possibly damaging	Het
Olfr27	T	C	9: 39,144,999	S300P	probably benign	Het
Olfr380	A	T	11: 73,454,001	D70E	probably damaging	Het
Olfr421-ps1	T	A	1: 174,152,312	Y265*	probably null	Het
Olfr53	T	C	7: 140,652,243	V88A	probably benign	Het
Olfr67	T	A	7: 103,787,995	H94L	probably benign	Het
Olfr901	T	G	9: 38,430,812	Y177D	probably damaging	Het
Olfr933	T	A	9: 38,975,759	F28I	probably damaging	Het
Patj	C	A	4: 98,677,321	N1090K	possibly damaging	Het
Pde8a	A	G	7: 81,328,035	D692G	probably benign	Het
Ppa2	G	T	3: 133,367,842	K220N	probably damaging	Het
Rad54b	A	G	4: 11,597,865	H250R	probably damaging	Het
Reln	A	C	5: 21,920,487	C2733G	probably damaging	Het
Rgs14	A	G	13: 55,383,753	T497A	probably damaging	Het
Rpl13-ps3	T	A	14: 58,893,523		noncoding transcript	Het
Scn11a	T	G	9: 119,765,506	I1274L	probably damaging	Het
Sco1	A	T	11: 67,055,800	H133L	possibly damaging	Het
Slc4a8	T	C	15: 100,796,640		probably null	Het
Smc2	C	T	4: 52,440,238		probably benign	Het
Spata18	T	C	5: 73,666,902	I156T	probably benign	Het
St3gal2	T	C	8: 110,962,359	M177T	probably benign	Het
Stt3a	A	G	9: 36,763,344	F48L	probably damaging	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Szt2	A	G	4: 118,365,406		probably benign	Het
Telo2	A	T	17: 25,115,256	S6T	possibly damaging	Het
Tnfrsf11b	T	C	15: 54,252,095	M369V	probably benign	Het
Tnfrsf13b	C	G	11: 61,140,817		probably null	Het
Vmn1r234	A	T	17: 21,229,021	M66L	probably benign	Het
Vmn2r12	C	A	5: 109,091,964	M244I	probably benign	Het
Wdfy2	T	A	14: 62,925,140	L97*	probably null	Het
Wdr63	C	T	3: 146,068,806	D429N	probably damaging	Het
Xrcc5	T	C	1: 72,394,720	*733Q	probably null	Het
Zadh2	A	T	18: 84,094,501	I101F	possibly damaging	Het
Zfp516	G	A	18: 82,987,497	G842D	possibly damaging	Het
Zwilch	A	G	9: 64,155,162		probably null	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCATTGGCATCCCCTGTGTAG -3'
(R):5'- CATCTTTGCTGTGCCCAGTG -3'

Sequencing Primer
(F):5'- TGTAGTACAGTGGTGAGGAGGC -3'
(R):5'- CCCAGGCTATGAGAGAAGCC -3'

Posted On

2015-06-20