Incidental Mutation 'R4299:C4b'
ID323517
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 041087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4299 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34731144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1384 (D1384G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: D1384G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D1384G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (76/78)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,487,526 R208G possibly damaging Het
Abcc12 T C 8: 86,531,525 probably null Het
Akna A T 4: 63,398,032 D31E possibly damaging Het
Apbb2 A T 5: 66,313,378 H528Q probably damaging Het
Atp6v1g3 C A 1: 138,283,724 Y47* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
BC048403 C A 10: 121,745,446 H117Q probably benign Het
C87499 T C 4: 88,628,182 K137E probably damaging Het
Cbfa2t2 G A 2: 154,523,928 V353I probably damaging Het
Cdh7 T C 1: 110,061,001 I211T probably damaging Het
Cep170b T C 12: 112,739,305 S1166P probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs G A 16: 22,805,411 Q149* probably null Het
Cyp2c70 T C 19: 40,183,928 Q90R probably benign Het
Cyp3a41b T C 5: 145,573,677 Y129C possibly damaging Het
Dnah10 A G 5: 124,819,925 T3645A probably damaging Het
Dolk A T 2: 30,285,188 W282R probably damaging Het
Dsg2 T A 18: 20,595,951 probably null Het
Dysf A G 6: 84,068,077 T297A possibly damaging Het
Flt1 G T 5: 147,683,907 D142E probably benign Het
Frmd4a C A 2: 4,333,071 N29K probably benign Het
Fxyd7 A T 7: 31,044,982 M36K probably benign Het
Gabbr1 C T 17: 37,055,900 R178* probably null Het
Gm14139 G A 2: 150,190,733 D17N probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Gprc5b G A 7: 118,984,214 A144V possibly damaging Het
Il1rapl1 A T X: 87,300,707 I194N probably damaging Het
Klhl24 T C 16: 20,107,004 M94T probably damaging Het
Kmt2e T A 5: 23,464,914 I133N probably damaging Het
Macf1 A G 4: 123,399,406 I5381T probably damaging Het
Madd A G 2: 91,169,803 L197P probably damaging Het
Mapkapk3 G A 9: 107,257,449 T296M probably damaging Het
Micall2 T C 5: 139,709,471 probably benign Het
Myh9 T C 15: 77,769,964 T1214A probably benign Het
Ncapd3 A G 9: 27,052,327 N492S probably benign Het
Neurl4 A C 11: 69,909,061 D1055A probably damaging Het
Nrbp1 T C 5: 31,250,599 probably null Het
Olfr1052 A T 2: 86,298,241 I142F possibly damaging Het
Olfr27 T C 9: 39,144,999 S300P probably benign Het
Olfr380 A T 11: 73,454,001 D70E probably damaging Het
Olfr421-ps1 T A 1: 174,152,312 Y265* probably null Het
Olfr53 T C 7: 140,652,243 V88A probably benign Het
Olfr67 T A 7: 103,787,995 H94L probably benign Het
Olfr901 T G 9: 38,430,812 Y177D probably damaging Het
Olfr933 T A 9: 38,975,759 F28I probably damaging Het
Patj C A 4: 98,677,321 N1090K possibly damaging Het
Pde8a A G 7: 81,328,035 D692G probably benign Het
Ppa2 G T 3: 133,367,842 K220N probably damaging Het
Rad54b A G 4: 11,597,865 H250R probably damaging Het
Reln A C 5: 21,920,487 C2733G probably damaging Het
Rgs14 A G 13: 55,383,753 T497A probably damaging Het
Rpl13-ps3 T A 14: 58,893,523 noncoding transcript Het
Scn11a T G 9: 119,765,506 I1274L probably damaging Het
Sco1 A T 11: 67,055,800 H133L possibly damaging Het
Slc4a8 T C 15: 100,796,640 probably null Het
Smc2 C T 4: 52,440,238 probably benign Het
Spata18 T C 5: 73,666,902 I156T probably benign Het
St3gal2 T C 8: 110,962,359 M177T probably benign Het
Stt3a A G 9: 36,763,344 F48L probably damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Szt2 A G 4: 118,365,406 probably benign Het
Telo2 A T 17: 25,115,256 S6T possibly damaging Het
Tnfrsf11b T C 15: 54,252,095 M369V probably benign Het
Tnfrsf13b C G 11: 61,140,817 probably null Het
Vmn1r234 A T 17: 21,229,021 M66L probably benign Het
Vmn2r12 C A 5: 109,091,964 M244I probably benign Het
Wdfy2 T A 14: 62,925,140 L97* probably null Het
Wdr63 C T 3: 146,068,806 D429N probably damaging Het
Xrcc5 T C 1: 72,394,720 *733Q probably null Het
Zadh2 A T 18: 84,094,501 I101F possibly damaging Het
Zfp516 G A 18: 82,987,497 G842D possibly damaging Het
Zwilch A G 9: 64,155,162 probably null Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATTGGCATCCCCTGTGTAG -3'
(R):5'- CATCTTTGCTGTGCCCAGTG -3'

Sequencing Primer
(F):5'- TGTAGTACAGTGGTGAGGAGGC -3'
(R):5'- CCCAGGCTATGAGAGAAGCC -3'
Posted On2015-06-20