Incidental Mutation 'R8984:Xdh'
ID 683929
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R8984 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73921351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 352 (G352R)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: G352R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: G352R

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,351,815 V10E probably benign Het
AI467606 A T 7: 127,092,501 I83F probably damaging Het
Atn1 A T 6: 124,746,960 W437R unknown Het
Atxn7l2 T C 3: 108,208,974 probably benign Het
AU040320 T C 4: 126,841,143 F750S possibly damaging Het
B3gnt6 A G 7: 98,193,614 S380P probably benign Het
Bod1l T C 5: 41,788,872 Q3020R probably damaging Het
Borcs6 A T 11: 69,060,002 I69F probably benign Het
Brd7 T A 8: 88,354,712 M170L probably benign Het
Cit C T 5: 115,926,475 T472I possibly damaging Het
Ddx25 G T 9: 35,557,389 D57E probably benign Het
Dnah7a A T 1: 53,635,277 L447* probably null Het
Epb41l3 A G 17: 69,247,646 D247G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etaa1 A T 11: 17,940,254 V869E probably damaging Het
Exoc8 T A 8: 124,896,030 I533F probably benign Het
Fam117a A G 11: 95,363,997 probably null Het
Fam222a C T 5: 114,611,031 T96I possibly damaging Het
Fam71b C A 11: 46,404,868 Y22* probably null Het
Farsa C T 8: 84,867,599 T326I probably damaging Het
Fkbp1b T A 12: 4,841,401 D12V probably damaging Het
Gc C T 5: 89,441,562 probably null Het
Git2 T C 5: 114,730,195 E705G probably damaging Het
Gm10318 G A 10: 77,853,244 C128Y unknown Het
Hcar2 G A 5: 123,864,508 R311* probably null Het
Hira A G 16: 18,927,511 Q468R possibly damaging Het
Hist1h3c C A 13: 23,745,410 A30S probably benign Het
Hspa1l T C 17: 34,978,116 V377A probably damaging Het
Igkv2-137 T A 6: 67,555,675 W14R probably damaging Het
Itga3 A T 11: 95,062,565 L317Q probably damaging Het
Jade2 A C 11: 51,825,079 L433W probably damaging Het
Kif21a T C 15: 90,956,356 T1186A probably benign Het
Krtap28-10 C A 1: 83,042,173 C82F unknown Het
Ksr1 G A 11: 79,040,883 T333M probably damaging Het
Msi1 T C 5: 115,435,539 F132S probably damaging Het
Myo7b C A 18: 31,966,349 K1673N probably null Het
Myom3 T A 4: 135,787,944 N716K Het
Ndst4 G A 3: 125,722,161 G312R probably damaging Het
Ndufaf2 A G 13: 108,052,782 V144A probably benign Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr328 G C 11: 58,551,383 N285K probably damaging Het
Olfr558 T A 7: 102,710,012 I251N possibly damaging Het
Olfr594 T C 7: 103,220,186 L156P possibly damaging Het
Olfr628 T C 7: 103,732,013 I29T probably damaging Het
Olfr64 G A 7: 103,893,609 T42I probably benign Het
Omd T C 13: 49,590,100 S209P possibly damaging Het
Patl1 T A 19: 11,921,396 Y152N probably damaging Het
Plaur T A 7: 24,465,152 M27K probably benign Het
Ppfia3 A G 7: 45,340,676 V1142A probably damaging Het
Psg28 T A 7: 18,423,056 N418I probably damaging Het
Ptprd A T 4: 75,945,014 F1237I probably damaging Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rbms3 A T 9: 116,695,818 probably null Het
Rgs18 A G 1: 144,753,828 V231A probably benign Het
Rnf112 T C 11: 61,452,451 R156G possibly damaging Het
Rsad1 A C 11: 94,548,184 V150G probably damaging Het
Rxrg G A 1: 167,634,436 V350I possibly damaging Het
Sash1 A G 10: 8,751,044 I192T possibly damaging Het
Slc25a36 G A 9: 97,079,206 T259I probably benign Het
Smarcd3 T A 5: 24,593,988 E324V probably null Het
St3gal4 A G 9: 35,055,648 V2A possibly damaging Het
Stk17b A C 1: 53,757,625 S328A probably benign Het
Tbrg1 A G 9: 37,652,653 Y229H probably damaging Het
Tdg A G 10: 82,648,680 N409S probably benign Het
Terb1 T C 8: 104,485,404 E315G possibly damaging Het
Tmem131 A G 1: 36,828,147 F402L probably benign Het
Trav4-2 T C 14: 53,418,733 I64T probably benign Het
Trav4-4-dv10 A G 14: 53,684,117 T91A probably benign Het
Zfp551 C A 7: 12,422,632 probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9149:Xdh UTSW 17 73915693 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9357:Xdh UTSW 17 73926546 critical splice donor site probably null
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATCACTGAATTTGGGGC -3'
(R):5'- GAGTTGACACATGCGTACTTTTC -3'

Sequencing Primer
(F):5'- GGCTCTGTTTCTCTAGAAAAGGACC -3'
(R):5'- CACATGCGTACTTTTCAGAGCTGAG -3'
Posted On 2021-10-11