Mutagenetix > Incidental Mutation

Incidental Mutation 'R2156:Usp34'

234840

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

040159-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R2156 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23382602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1110 (F1110I)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: F1129I

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: F1129I

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: F1110I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: F1110I

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,422,308		probably null	Het
Acaa2	T	C	18: 74,793,405		probably null	Het
Adam7	T	C	14: 68,511,343	Q485R	probably benign	Het
Adcy4	T	G	14: 55,769,170	T1069P	probably benign	Het
Arsj	T	C	3: 126,438,688	L361P	probably damaging	Het
Birc2	A	C	9: 7,826,938	L349R	probably damaging	Het
C1qa	T	C	4: 136,896,416	Y159C	probably damaging	Het
Cdh13	A	G	8: 119,236,964	K428E	probably damaging	Het
Cenpe	T	C	3: 135,247,474	M1563T	probably benign	Het
Col10a1	T	C	10: 34,395,700	V556A	probably benign	Het
Creg2	G	A	1: 39,623,170	L265F	probably damaging	Het
Cyp1a2	T	A	9: 57,682,150	D127V	probably damaging	Het
Cyp3a44	A	T	5: 145,803,670	Y53*	probably null	Het
Cyth1	C	T	11: 118,182,808	R233Q	probably damaging	Het
Dnmbp	G	A	19: 43,901,907	H474Y	possibly damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ercc2	G	A	7: 19,386,792	R206H	possibly damaging	Het
Evx2	T	A	2: 74,656,016	H343L	probably damaging	Het
Fcrls	T	A	3: 87,257,341	I293F	probably benign	Het
Gcnt4	A	G	13: 96,946,466	E90G	probably damaging	Het
Gid8	T	G	2: 180,716,958	C139G	probably benign	Het
Gm11938	C	A	11: 99,603,107	C54F	probably damaging	Het
Gm3336	G	A	8: 70,721,860	V158I	probably benign	Het
Gm5415	T	A	1: 32,546,047	M261L	probably benign	Het
Gucy1b1	T	C	3: 82,061,020	N60D	probably benign	Het
Hdac7	T	C	15: 97,794,063	K810E	probably benign	Het
Hsp90ab1	A	G	17: 45,569,703	F361L	possibly damaging	Het
Igf2bp3	A	T	6: 49,108,924		probably null	Het
Inpp4b	T	A	8: 82,048,489	I772N	probably damaging	Het
Iqca	A	G	1: 90,089,516	L390P	possibly damaging	Het
Itgb2	C	T	10: 77,560,248	R586W	probably benign	Het
Itih1	A	G	14: 30,933,475	S588P	possibly damaging	Het
Iyd	T	A	10: 3,547,166		probably null	Het
Kl	A	G	5: 150,988,960	K725E	probably benign	Het
Layn	T	A	9: 51,057,397	M349L	probably benign	Het
Map3k5	T	C	10: 20,024,937	Y286H	probably damaging	Het
Med4	C	T	14: 73,518,032		probably benign	Het
Mfn1	T	A	3: 32,534,251	N42K	possibly damaging	Het
Mindy2	T	C	9: 70,656,592	D152G	probably benign	Het
Mrc2	A	G	11: 105,347,856		probably null	Het
Mrpl11	C	A	19: 4,962,469	A26E	probably damaging	Het
Msh6	G	A	17: 87,986,140	W774*	probably null	Het
Mtch1	A	T	17: 29,342,867	V121E	probably damaging	Het
Mtg2	G	T	2: 180,084,130	E178*	probably null	Het
Nbas	A	T	12: 13,441,509	N1461Y	probably damaging	Het
Ndfip2	A	G	14: 105,287,770	T65A	probably benign	Het
Ninl	G	T	2: 150,944,583	Q1146K	probably damaging	Het
Notch1	T	C	2: 26,460,861	D2089G	possibly damaging	Het
Notch3	C	T	17: 32,147,844	V906M	probably damaging	Het
Olfr606	A	G	7: 103,452,164	I276V	probably benign	Het
Olfr711	A	G	7: 106,971,568	Y259H	probably damaging	Het
Osmr	A	T	15: 6,844,410	Y169N	probably benign	Het
Ovgp1	T	C	3: 105,977,717	V124A	possibly damaging	Het
P2rx1	T	C	11: 73,014,113	M369T	probably benign	Het
Pde4dip	T	C	3: 97,724,218	Q1125R	probably damaging	Het
Podn	A	T	4: 108,021,695	V180E	probably damaging	Het
Pold1	A	T	7: 44,539,118	V475E	probably damaging	Het
Polg	A	G	7: 79,461,720	I261T	possibly damaging	Het
Satb1	G	T	17: 51,740,410	Q595K	probably benign	Het
Scaf8	T	A	17: 3,164,132		probably null	Het
Serpinb3a	C	T	1: 107,047,472		probably null	Het
Slc22a26	T	C	19: 7,802,115	D112G	probably damaging	Het
Slc25a23	A	G	17: 57,045,562	F441L	probably benign	Het
Slc25a53	T	C	X: 136,983,467	T42A	probably damaging	Het
Slc6a15	T	C	10: 103,393,408	Y103H	probably damaging	Het
Slx4	A	G	16: 3,986,359	S864P	probably benign	Het
Snap91	T	C	9: 86,825,077	E220G	probably damaging	Het
Spam1	T	C	6: 24,796,268	F73L	probably damaging	Het
Sphkap	C	T	1: 83,277,989	V393M	probably benign	Het
Spred2	T	C	11: 20,021,241	Y370H	probably damaging	Het
Sqle	T	C	15: 59,323,729		probably null	Het
Srrm2	A	G	17: 23,818,263	T1390A	probably benign	Het
Tas1r2	A	G	4: 139,669,041	R564G	possibly damaging	Het
Tbl2	G	T	5: 135,156,520		probably null	Het
Tcof1	T	C	18: 60,831,829	D606G	possibly damaging	Het
Tdpoz3	T	A	3: 93,826,780	L254H	probably damaging	Het
Trpm1	A	T	7: 64,234,988	I806F	probably damaging	Het
Ttc22	A	G	4: 106,639,040	D429G	probably benign	Het
Ube2o	C	A	11: 116,581,146	G90C	probably damaging	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Vps35	A	G	8: 85,286,500	V116A	probably benign	Het
Wdfy3	A	G	5: 101,898,425		probably null	Het
Zeb2	T	C	2: 44,988,809	K1138E	probably benign	Het
Zfp513	G	A	5: 31,200,522	T169I	probably benign	Het
Zfp629	T	C	7: 127,612,379	D86G	probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTATACATCTGTTCAGGCTTTGC -3'
(R):5'- GGGGAAATCACACCAAAATTGC -3'

Sequencing Primer
(F):5'- CAGGCTTTGCGTGTTAAATTATTC -3'
(R):5'- ATCACACCAAAATTGCTTTCAAAG -3'

Posted On

2014-10-01