Incidental Mutation 'R4707:Usp34'
ID 355347
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 041955-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R4707 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23437215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 3326 (L3326S)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129368
AA Change: L233S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342
AA Change: L233S

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: L3345S
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: L3345S

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: L3326S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: L3326S

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,224,544 (GRCm39) K450R probably damaging Het
Abcd2 T C 15: 91,043,385 (GRCm39) D601G probably benign Het
Abcf3 A G 16: 20,367,808 (GRCm39) K56E possibly damaging Het
Acaca T C 11: 84,203,680 (GRCm39) V1477A probably damaging Het
Adamts20 G A 15: 94,231,528 (GRCm39) P887L possibly damaging Het
Ahnak T G 19: 8,994,099 (GRCm39) S5128A probably benign Het
Ahsa2 C A 11: 23,443,162 (GRCm39) V197F probably benign Het
Ak9 C A 10: 41,221,456 (GRCm39) H402N probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Ankrd16 A G 2: 11,783,608 (GRCm39) D70G probably damaging Het
Apob A T 12: 8,056,205 (GRCm39) K1562N probably damaging Het
Arfgap2 C A 2: 91,100,316 (GRCm39) S250R probably damaging Het
Arhgef10l C T 4: 140,264,194 (GRCm39) M671I possibly damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
B4galnt2 C T 11: 95,766,923 (GRCm39) probably null Het
C8a A G 4: 104,713,618 (GRCm39) Y171H probably damaging Het
Cacnb4 A G 2: 52,364,927 (GRCm39) V112A probably benign Het
Capn9 G T 8: 125,340,195 (GRCm39) C566F possibly damaging Het
Ccdc88a T A 11: 29,397,956 (GRCm39) S230T probably benign Het
Cd300c2 A T 11: 114,887,811 (GRCm39) F197Y probably benign Het
Chd5 A G 4: 152,445,039 (GRCm39) Y340C probably damaging Het
Chrd A T 16: 20,557,558 (GRCm39) I726F possibly damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clasp1 T A 1: 118,470,927 (GRCm39) Y197* probably null Het
Cyp2c69 C G 19: 39,837,852 (GRCm39) G410A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dapp1 T C 3: 137,638,928 (GRCm39) D225G probably benign Het
Dnah5 A T 15: 28,372,521 (GRCm39) D2924V probably damaging Het
Efcab12 A T 6: 115,791,510 (GRCm39) L554Q possibly damaging Het
Emsy T C 7: 98,246,311 (GRCm39) T228A possibly damaging Het
Evc2 G A 5: 37,579,204 (GRCm39) V1106I probably benign Het
Exoc8 G T 8: 125,624,209 (GRCm39) Q53K possibly damaging Het
Fbn2 A T 18: 58,189,344 (GRCm39) V1594D probably damaging Het
Fer1l4 T C 2: 155,887,543 (GRCm39) Y551C possibly damaging Het
Fhip1a G T 3: 85,595,877 (GRCm39) T115K probably damaging Het
Fmnl3 A G 15: 99,221,362 (GRCm39) M481T probably benign Het
Fras1 A G 5: 96,883,097 (GRCm39) N2543S probably damaging Het
Fsd2 T C 7: 81,209,428 (GRCm39) D138G probably damaging Het
Gda C T 19: 21,405,992 (GRCm39) V5I probably benign Het
Glt8d2 A T 10: 82,496,583 (GRCm39) D158E probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Greb1l A G 18: 10,532,922 (GRCm39) M830V probably benign Het
Hnrnpul1 A C 7: 25,426,258 (GRCm39) V531G probably damaging Het
Ifi206 A T 1: 173,308,432 (GRCm39) H521Q probably benign Het
Igsf3 G C 3: 101,365,410 (GRCm39) R1127P probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Islr T C 9: 58,064,970 (GRCm39) D179G possibly damaging Het
Jcad G T 18: 4,649,338 (GRCm39) E70* probably null Het
Kcnd2 T C 6: 21,723,211 (GRCm39) I467T probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Lrrtm3 T A 10: 63,923,781 (GRCm39) H462L probably benign Het
Mbd5 T C 2: 49,140,168 (GRCm39) L44S probably damaging Het
Mccc1 C A 3: 36,030,022 (GRCm39) M429I probably damaging Het
Mgam A T 6: 40,691,566 (GRCm39) probably null Het
Mipep T A 14: 61,109,552 (GRCm39) I643N probably damaging Het
Mmrn1 A T 6: 60,965,457 (GRCm39) I1162L probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mug1 G A 6: 121,861,600 (GRCm39) C1354Y probably damaging Het
Nbeal2 A T 9: 110,461,123 (GRCm39) S1647T probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nedd9 A T 13: 41,492,051 (GRCm39) probably null Het
Nr4a2 T A 2: 57,002,105 (GRCm39) H116L probably benign Het
Nwd2 A G 5: 63,951,665 (GRCm39) Y232C probably damaging Het
Odf4 A G 11: 68,817,514 (GRCm39) L58P probably damaging Het
Or2a20 T A 6: 43,193,883 (GRCm39) V12D probably benign Het
Or4a27 T A 2: 88,559,056 (GRCm39) M296L possibly damaging Het
Or4c116 A T 2: 88,942,576 (GRCm39) F93L probably damaging Het
Or4g17 T A 2: 111,209,990 (GRCm39) L215H probably damaging Het
Or7e165 C T 9: 19,694,596 (GRCm39) H18Y probably damaging Het
Or8g24 A G 9: 38,989,558 (GRCm39) V161A probably benign Het
Or8s5 G T 15: 98,238,659 (GRCm39) H70Q possibly damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Pikfyve A G 1: 65,307,005 (GRCm39) T1798A probably benign Het
Prdx6b T C 2: 80,123,404 (GRCm39) L71P probably damaging Het
Prmt2 A G 10: 76,062,055 (GRCm39) I50T probably damaging Het
Ptdss1 T C 13: 67,143,482 (GRCm39) probably null Het
Pygl T C 12: 70,254,532 (GRCm39) T138A possibly damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rev3l T A 10: 39,699,393 (GRCm39) S1297T probably damaging Het
Rgma C A 7: 73,067,564 (GRCm39) T367K probably damaging Het
Rps6ka5 C T 12: 100,564,144 (GRCm39) probably null Het
Rslcan18 A T 13: 67,246,590 (GRCm39) C217S probably damaging Het
Rtp3 A G 9: 110,815,279 (GRCm39) probably benign Het
Ryr1 A T 7: 28,745,087 (GRCm39) N3848K probably damaging Het
Sema6a T A 18: 47,381,779 (GRCm39) T923S probably benign Het
Serpinb6d A T 13: 33,855,336 (GRCm39) T337S possibly damaging Het
Sf3b1 G A 1: 55,029,666 (GRCm39) T1112M probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sidt1 A T 16: 44,090,221 (GRCm39) Y369* probably null Het
Slc16a6 A G 11: 109,354,193 (GRCm39) S59P probably benign Het
Slc25a17 A C 15: 81,211,527 (GRCm39) L163W probably damaging Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Sptbn1 T C 11: 30,087,197 (GRCm39) T1081A possibly damaging Het
Sptbn4 T C 7: 27,116,431 (GRCm39) D456G probably benign Het
Sycp1 C A 3: 102,760,805 (GRCm39) A703S possibly damaging Het
Tas2r118 T A 6: 23,969,225 (GRCm39) M279L probably benign Het
Tc2n T G 12: 101,660,832 (GRCm39) Q133H probably benign Het
Tctn1 A G 5: 122,399,468 (GRCm39) probably null Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tex10 A T 4: 48,468,984 (GRCm39) S64T probably benign Het
Tex15 A G 8: 34,072,525 (GRCm39) T2691A probably benign Het
Tmem175 A T 5: 108,790,016 (GRCm39) T123S probably damaging Het
Tsc1 C A 2: 28,562,419 (GRCm39) S348R probably damaging Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Ttll8 A T 15: 88,801,293 (GRCm39) I465N probably damaging Het
Ubr3 A G 2: 69,768,714 (GRCm39) probably benign Het
Ugdh A T 5: 65,580,695 (GRCm39) probably null Het
Vmn2r125 A T 4: 156,702,276 (GRCm39) I21F probably damaging Het
Vps9d1 G A 8: 123,975,351 (GRCm39) probably benign Het
Xab2 G A 8: 3,668,117 (GRCm39) R154C possibly damaging Het
Zbtb12 T C 17: 35,114,475 (GRCm39) S87P probably damaging Het
Zc3h12a A G 4: 125,014,686 (GRCm39) M266T probably damaging Het
Zfp108 G A 7: 23,959,837 (GRCm39) A143T probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTTCTGAAATGTCATTTCTGC -3'
(R):5'- TCAGTCTTACGTTCTCAGTACTGG -3'

Sequencing Primer
(F):5'- AGGATTTGTTTTGTGCATGTACAC -3'
(R):5'- CGTTCTCAGTACTGGAAAATATGTGC -3'
Posted On 2015-10-21