Mutagenetix > Incidental Mutation

Incidental Mutation 'R4707:Usp34'

355347

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

041955-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R4707 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23487215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 3326 (L3326S)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020529

SMART Domains

Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	163	2.52e-57	SMART
Pfam:AHSA1	209	325	1.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109539

SMART Domains

Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	2	115	2.33e-38	SMART
Pfam:AHSA1	161	277	4.3e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124801

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125701

Predicted Effect

probably benign
Transcript: ENSMUST00000128372

SMART Domains

Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	15	149	2.52e-57	SMART
Pfam:AHSA1	195	311	7.5e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129368
AA Change: L233S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342
AA Change: L233S

Domain	Start	End	E-Value	Type
Blast:Drf_GBD	2	86	1e-19	BLAST
low complexity region	231	244	N/A	INTRINSIC
coiled coil region	259	281	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: L3345S

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: L3345S

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147157

SMART Domains

Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	138	4.15e-26	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153409

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: L3326S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: L3326S

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 9,005,712	K450R	probably damaging	Het
Abcd2	T	C	15: 91,159,182	D601G	probably benign	Het
Abcf3	A	G	16: 20,549,058	K56E	possibly damaging	Het
Acaca	T	C	11: 84,312,854	V1477A	probably damaging	Het
Adamts20	G	A	15: 94,333,647	P887L	possibly damaging	Het
Ahnak	T	G	19: 9,016,735	S5128A	probably benign	Het
Ahsa2	C	A	11: 23,493,162	V197F	probably benign	Het
Ak9	C	A	10: 41,345,460	H402N	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Ankrd16	A	G	2: 11,778,797	D70G	probably damaging	Het
Apob	A	T	12: 8,006,205	K1562N	probably damaging	Het
Arfgap2	C	A	2: 91,269,971	S250R	probably damaging	Het
Arhgef10l	C	T	4: 140,536,883	M671I	possibly damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B4galnt2	C	T	11: 95,876,097		probably null	Het
C8a	A	G	4: 104,856,421	Y171H	probably damaging	Het
Cacnb4	A	G	2: 52,474,915	V112A	probably benign	Het
Capn9	G	T	8: 124,613,456	C566F	possibly damaging	Het
Ccdc88a	T	A	11: 29,447,956	S230T	probably benign	Het
Cd300c2	A	T	11: 114,996,985	F197Y	probably benign	Het
Chd5	A	G	4: 152,360,582	Y340C	probably damaging	Het
Chrd	A	T	16: 20,738,808	I726F	possibly damaging	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Clasp1	T	A	1: 118,543,197	Y197*	probably null	Het
Cyp2c69	C	G	19: 39,849,408	G410A	probably benign	Het
Cyp2e1	G	A	7: 140,763,908	V20I	possibly damaging	Het
Dapp1	T	C	3: 137,933,167	D225G	probably benign	Het
Dnah5	A	T	15: 28,372,375	D2924V	probably damaging	Het
Efcab12	A	T	6: 115,814,549	L554Q	possibly damaging	Het
Emsy	T	C	7: 98,597,104	T228A	possibly damaging	Het
Evc2	G	A	5: 37,421,860	V1106I	probably benign	Het
Exoc8	G	T	8: 124,897,470	Q53K	possibly damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fbn2	A	T	18: 58,056,272	V1594D	probably damaging	Het
Fer1l4	T	C	2: 156,045,623	Y551C	possibly damaging	Het
Fmnl3	A	G	15: 99,323,481	M481T	probably benign	Het
Fras1	A	G	5: 96,735,238	N2543S	probably damaging	Het
Fsd2	T	C	7: 81,559,680	D138G	probably damaging	Het
Gda	C	T	19: 21,428,628	V5I	probably benign	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Greb1l	A	G	18: 10,532,922	M830V	probably benign	Het
Hnrnpul1	A	C	7: 25,726,833	V531G	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Igsf3	G	C	3: 101,458,094	R1127P	probably benign	Het
Il1rl1	A	G	1: 40,450,188	R367G	probably damaging	Het
Islr	T	C	9: 58,157,687	D179G	possibly damaging	Het
Jcad	G	T	18: 4,649,338	E70*	probably null	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Lrrc27	A	G	7: 139,242,698	T502A	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Mbd5	T	C	2: 49,250,156	L44S	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Mgam	A	T	6: 40,714,632		probably null	Het
Mipep	T	A	14: 60,872,103	I643N	probably damaging	Het
Mmrn1	A	T	6: 60,988,473	I1162L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mug1	G	A	6: 121,884,641	C1354Y	probably damaging	Het
Nbeal2	A	T	9: 110,632,055	S1647T	probably benign	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nedd9	A	T	13: 41,338,575		probably null	Het
Nr4a2	T	A	2: 57,112,093	H116L	probably benign	Het
Nwd2	A	G	5: 63,794,322	Y232C	probably damaging	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1197	T	A	2: 88,728,712	M296L	possibly damaging	Het
Olfr1221	A	T	2: 89,112,232	F93L	probably damaging	Het
Olfr1284	T	A	2: 111,379,645	L215H	probably damaging	Het
Olfr284	G	T	15: 98,340,778	H70Q	possibly damaging	Het
Olfr434	T	A	6: 43,216,949	V12D	probably benign	Het
Olfr58	C	T	9: 19,783,300	H18Y	probably damaging	Het
Olfr938	A	G	9: 39,078,262	V161A	probably benign	Het
Orc6	T	A	8: 85,302,950	I41K	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Prdx6b	T	C	2: 80,293,060	L71P	probably damaging	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptdss1	T	C	13: 66,995,418		probably null	Het
Pygl	T	C	12: 70,207,758	T138A	possibly damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rbl2	A	G	8: 91,085,568	Y255C	probably damaging	Het
Rev3l	T	A	10: 39,823,397	S1297T	probably damaging	Het
Rgma	C	A	7: 73,417,816	T367K	probably damaging	Het
Rps6ka5	C	T	12: 100,597,885		probably null	Het
Rslcan18	A	T	13: 67,098,526	C217S	probably damaging	Het
Rtp3	A	G	9: 110,986,211		probably benign	Het
Ryr1	A	T	7: 29,045,662	N3848K	probably damaging	Het
Sema6a	T	A	18: 47,248,712	T923S	probably benign	Het
Serpinb6d	A	T	13: 33,671,353	T337S	possibly damaging	Het
Sf3b1	G	A	1: 54,990,507	T1112M	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sidt1	A	T	16: 44,269,858	Y369*	probably null	Het
Slc16a6	A	G	11: 109,463,367	S59P	probably benign	Het
Slc25a17	A	C	15: 81,327,326	L163W	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Sptbn1	T	C	11: 30,137,197	T1081A	possibly damaging	Het
Sptbn4	T	C	7: 27,417,006	D456G	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r118	T	A	6: 23,969,226	M279L	probably benign	Het
Tc2n	T	G	12: 101,694,573	Q133H	probably benign	Het
Tctn1	A	G	5: 122,261,405		probably null	Het
Tenm4	A	C	7: 96,774,046	K683Q	probably damaging	Het
Tex10	A	T	4: 48,468,984	S64T	probably benign	Het
Tex15	A	G	8: 33,582,497	T2691A	probably benign	Het
Tmem175	A	T	5: 108,642,150	T123S	probably damaging	Het
Tsc1	C	A	2: 28,672,407	S348R	probably damaging	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttll8	A	T	15: 88,917,090	I465N	probably damaging	Het
Ubr3	A	G	2: 69,938,370		probably benign	Het
Ugdh	A	T	5: 65,423,352		probably null	Het
Vmn2r125	A	T	4: 156,349,981	I21F	probably damaging	Het
Vps9d1	G	A	8: 123,248,612		probably benign	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zbtb12	T	C	17: 34,895,499	S87P	probably damaging	Het
Zc3h12a	A	G	4: 125,120,893	M266T	probably damaging	Het
Zfp108	G	A	7: 24,260,412	A143T	probably benign	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCTTCTGAAATGTCATTTCTGC -3'
(R):5'- TCAGTCTTACGTTCTCAGTACTGG -3'

Sequencing Primer
(F):5'- AGGATTTGTTTTGTGCATGTACAC -3'
(R):5'- CGTTCTCAGTACTGGAAAATATGTGC -3'

Posted On

2015-10-21