Incidental Mutation 'R8987:Usp34'
ID 684132
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 068819-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R8987 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23414267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2756 (M2756L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: M2756L

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: M2737L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: M2737L

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 96% (123/128)
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T C 5: 113,830,813 (GRCm39) K59R unknown Het
Abcb4 T C 5: 8,977,931 (GRCm39) V503A probably benign Het
Actn4 A G 7: 28,596,398 (GRCm39) V699A probably benign Het
Adam26a T A 8: 44,022,358 (GRCm39) K377N probably benign Het
Adam6b C T 12: 113,454,748 (GRCm39) R522C probably damaging Het
Ahi1 A G 10: 20,839,683 (GRCm39) Y198C probably damaging Het
Ankrd44 G A 1: 54,700,349 (GRCm39) Q720* probably null Het
Arhgap26 A T 18: 39,490,652 (GRCm39) M297L Het
Arhgef11 C T 3: 87,637,788 (GRCm39) T1093I probably damaging Het
Arhgef25 C A 10: 127,018,735 (GRCm39) R609S probably damaging Het
Arhgef28 G T 13: 98,190,472 (GRCm39) H162Q possibly damaging Het
Atg4b A G 1: 93,706,081 (GRCm39) E178G possibly damaging Het
Atxn1l T C 8: 110,459,117 (GRCm39) T382A probably benign Het
Bdp1 A G 13: 100,204,021 (GRCm39) V667A probably benign Het
C6 T C 15: 4,844,344 (GRCm39) I922T Het
Ccdc191 A G 16: 43,751,710 (GRCm39) T347A probably benign Het
Cd22 G T 7: 30,577,172 (GRCm39) P45H probably damaging Het
Cdc45 A G 16: 18,630,300 (GRCm39) F6L probably benign Het
Cenpj T C 14: 56,764,383 (GRCm39) E1343G possibly damaging Het
Chtf8 T A 8: 107,612,735 (GRCm39) N68I probably benign Het
Cldn8 C T 16: 88,359,733 (GRCm39) C64Y probably damaging Het
Cntnap2 G T 6: 46,460,983 (GRCm39) S673I probably benign Het
Cyp3a13 C T 5: 137,909,849 (GRCm39) R158K probably benign Het
Cyp3a57 A T 5: 145,311,039 (GRCm39) probably null Het
Cyp3a57 G T 5: 145,311,040 (GRCm39) probably null Het
D630045J12Rik A G 6: 38,173,898 (GRCm39) I90T probably benign Het
Dapk2 A G 9: 66,157,602 (GRCm39) probably benign Het
Dmxl1 A G 18: 50,026,919 (GRCm39) D2009G Het
Dnah1 C T 14: 31,033,704 (GRCm39) V290I possibly damaging Het
Doc2g A T 19: 4,054,511 (GRCm39) probably null Het
Dpysl2 C T 14: 67,045,402 (GRCm39) G457D probably damaging Het
Drc1 A T 5: 30,521,439 (GRCm39) Y700F probably damaging Het
Ehbp1 A G 11: 22,003,531 (GRCm39) Y1073H probably damaging Het
Epm2aip1 T A 9: 111,101,036 (GRCm39) M3K probably benign Het
Erich3 G A 3: 154,415,340 (GRCm39) R152Q Het
Exoc5 C T 14: 49,252,986 (GRCm39) R609H probably damaging Het
Fam135b T A 15: 71,334,189 (GRCm39) T1002S probably benign Het
Fanca C T 8: 124,024,538 (GRCm39) E528K probably damaging Het
Fsd2 C A 7: 81,209,766 (GRCm39) M25I probably benign Het
Fyco1 T C 9: 123,658,139 (GRCm39) E679G possibly damaging Het
Gas6 T A 8: 13,520,294 (GRCm39) M465L probably damaging Het
Gfra3 A G 18: 34,823,879 (GRCm39) V365A probably benign Het
Gm10269 T G 18: 20,815,981 (GRCm39) K14Q possibly damaging Het
Gm21798 G A 15: 64,689,756 (GRCm39) probably null Het
Gm5916 T A 9: 36,032,286 (GRCm39) R49S probably benign Het
Gpam G T 19: 55,072,227 (GRCm39) T266N possibly damaging Het
Gtse1 A G 15: 85,753,109 (GRCm39) E408G probably benign Het
Hmgcll1 A T 9: 76,037,592 (GRCm39) probably null Het
Hspa12a T A 19: 58,787,903 (GRCm39) R640* probably null Het
Hspa9 T C 18: 35,080,982 (GRCm39) D233G probably damaging Het
Htt T G 5: 34,977,368 (GRCm39) I751M probably benign Het
Hydin T A 8: 111,239,766 (GRCm39) Y2015* probably null Het
Ift43 A C 12: 86,208,275 (GRCm39) M138L probably benign Het
Il11 C T 7: 4,779,029 (GRCm39) V93M probably damaging Het
Iws1 T A 18: 32,226,645 (GRCm39) F741L possibly damaging Het
Jmy A T 13: 93,589,397 (GRCm39) I620N probably damaging Het
Kap T A 6: 133,830,689 (GRCm39) probably benign Het
Kcnk15 A G 2: 163,700,217 (GRCm39) N152S probably damaging Het
Kif16b T C 2: 142,743,278 (GRCm39) K5R probably benign Het
Kif16b C T 2: 142,691,783 (GRCm39) probably null Het
Kirrel1 C T 3: 86,992,400 (GRCm39) R555H probably damaging Het
Krt36 A G 11: 99,994,372 (GRCm39) V235A possibly damaging Het
Lca5 A G 9: 83,283,796 (GRCm39) S246P probably damaging Het
Maml1 T C 11: 50,157,575 (GRCm39) D200G probably damaging Het
Maml3 T C 3: 51,597,868 (GRCm39) R939G probably damaging Het
Mgam A T 6: 40,706,570 (GRCm39) T74S probably damaging Het
Mib2 G T 4: 155,745,351 (GRCm39) D125E probably benign Het
Muc16 A T 9: 18,462,981 (GRCm39) L7407* probably null Het
Mycbp2 A T 14: 103,446,232 (GRCm39) N1865K probably damaging Het
Naip1 A G 13: 100,563,434 (GRCm39) L577S probably damaging Het
Nell1 A T 7: 50,498,399 (GRCm39) D652V probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nxph1 G A 6: 8,950,312 (GRCm39) probably benign Het
Oas1h T A 5: 121,005,152 (GRCm39) I200N probably damaging Het
Or2h2b-ps1 A G 17: 37,480,867 (GRCm39) L122P probably damaging Het
Or2h2b-ps1 A T 17: 37,480,990 (GRCm39) I81N probably damaging Het
Or8g53 A T 9: 39,683,688 (GRCm39) M136K probably benign Het
Otog A T 7: 45,936,878 (GRCm39) Q1529L probably benign Het
Otop1 A T 5: 38,457,071 (GRCm39) I277F probably damaging Het
Pax5 G A 4: 44,645,661 (GRCm39) Q223* probably null Het
Pcdha9 T A 18: 37,132,998 (GRCm39) I689N probably benign Het
Pcsk6 A T 7: 65,576,975 (GRCm39) R138* probably null Het
Pitpnm3 A T 11: 72,003,132 (GRCm39) N59K probably damaging Het
Pla2g4d G A 2: 120,100,442 (GRCm39) T630I probably damaging Het
Plekhg5 T A 4: 152,188,372 (GRCm39) probably benign Het
Plxnb1 T A 9: 108,937,178 (GRCm39) probably benign Het
Prss28 T A 17: 25,528,395 (GRCm39) L6H probably damaging Het
Pyroxd1 T A 6: 142,302,251 (GRCm39) V228E Het
Ripk2 G A 4: 16,123,699 (GRCm39) T492M possibly damaging Het
Satb1 A T 17: 52,112,381 (GRCm39) C78S probably damaging Het
Scaf11 A T 15: 96,316,557 (GRCm39) C1002* probably null Het
Scarf2 A C 16: 17,622,768 (GRCm39) Q499P probably damaging Het
Selenbp1 T A 3: 94,847,425 (GRCm39) M244K probably benign Het
Sik2 T C 9: 50,806,647 (GRCm39) N921S probably benign Het
Slc25a1 A T 16: 17,743,744 (GRCm39) V290E probably damaging Het
Slc28a3 C T 13: 58,719,254 (GRCm39) probably benign Het
Slc35b4 A T 6: 34,137,442 (GRCm39) D213E probably benign Het
Slc40a1 A C 1: 45,950,495 (GRCm39) M319R probably damaging Het
Slc8a1 A T 17: 81,955,282 (GRCm39) F585L possibly damaging Het
Slco3a1 T A 7: 73,970,324 (GRCm39) N428Y possibly damaging Het
Slfn2 G A 11: 82,960,363 (GRCm39) C114Y probably damaging Het
Smg5 T C 3: 88,267,714 (GRCm39) probably null Het
Spata13 T A 14: 60,993,896 (GRCm39) L1116Q possibly damaging Het
Spmap1 C T 11: 97,666,510 (GRCm39) V59M probably damaging Het
Syne1 A G 10: 5,177,579 (GRCm39) V4965A possibly damaging Het
Tacc3 G T 5: 33,826,169 (GRCm39) V472F possibly damaging Het
Tacr3 T A 3: 134,560,573 (GRCm39) Y171N probably damaging Het
Tacr3 T G 3: 134,560,718 (GRCm39) L219R probably damaging Het
Tbx3 C A 5: 119,818,886 (GRCm39) A507E possibly damaging Het
Telo2 A T 17: 25,324,402 (GRCm39) D494E probably damaging Het
Tfip11 T C 5: 112,484,921 (GRCm39) F744S possibly damaging Het
Tgm3 A C 2: 129,880,403 (GRCm39) N403T probably benign Het
Thoc3 A T 13: 54,615,708 (GRCm39) S119T possibly damaging Het
Tmem176b A T 6: 48,812,530 (GRCm39) I145N probably damaging Het
Trio T A 15: 27,732,773 (GRCm39) Q3036L probably benign Het
Trpc4 T C 3: 54,102,132 (GRCm39) V10A probably benign Het
Trpm3 A G 19: 22,896,124 (GRCm39) Y987C probably damaging Het
Tspoap1 A G 11: 87,654,394 (GRCm39) K225E probably damaging Het
Txnrd3 A T 6: 89,638,477 (GRCm39) Q222L possibly damaging Het
Vmn2r81 C T 10: 79,129,704 (GRCm39) T865I probably damaging Het
Vnn1 A G 10: 23,776,714 (GRCm39) Y355C probably damaging Het
Wipf2 A T 11: 98,783,092 (GRCm39) S173C probably damaging Het
Wnt1 A T 15: 98,689,624 (GRCm39) H137L probably damaging Het
Xylt2 A T 11: 94,561,278 (GRCm39) C162S probably damaging Het
Zfp426 T C 9: 20,387,744 (GRCm39) E33G probably damaging Het
Zfp811 A C 17: 33,017,801 (GRCm39) C80G possibly damaging Het
Zfp931 T C 2: 177,709,591 (GRCm39) H265R probably damaging Het
Zfp931 G A 2: 177,709,592 (GRCm39) H265Y probably damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTTCTACCCCTACTCCC -3'
(R):5'- TCAGATAGGGCACTAGCTTTG -3'

Sequencing Primer
(F):5'- GGGATATGTAAAAGATGTCATGTCCC -3'
(R):5'- CTTTGTAGTGCCATGAACAGCAGC -3'
Posted On 2021-10-11