Mutagenetix > Incidental Mutation

Incidental Mutation 'R5981:Cnot1'

481415

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

043250-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5981 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96446079-96534092 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96515293 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 23 (K23E)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: K23E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: K23E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: K23E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: K23E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: K23E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably damaging
Transcript: ENSMUST00000212323
AA Change: K23E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: K23E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000213046
AA Change: K23E

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2fm2	T	C	3: 59,659,299 (GRCm39)	Y251H	probably benign	Het
Ccr3	G	A	9: 123,828,820 (GRCm39)	G52S	probably damaging	Het
Cep192	T	C	18: 67,993,661 (GRCm39)	L1992P	probably damaging	Het
Col12a1	G	A	9: 79,585,788 (GRCm39)	R1224C	probably damaging	Het
Cox7c	A	T	13: 86,194,780 (GRCm39)	S5R	possibly damaging	Het
Eps8	A	G	6: 137,459,208 (GRCm39)	V765A	probably damaging	Het
Frg1	T	C	8: 41,863,307 (GRCm39)	D104G	possibly damaging	Het
Gm11032	T	C	11: 4,571,697 (GRCm39)	V34A	probably benign	Het
Hid1	G	A	11: 115,241,774 (GRCm39)	T612I	possibly damaging	Het
Hivep1	C	T	13: 42,313,664 (GRCm39)	T1968I	probably damaging	Het
Mctp1	A	G	13: 76,905,229 (GRCm39)	D444G	probably damaging	Het
Ms4a1	T	C	19: 11,229,180 (GRCm39)	E242G	probably benign	Het
Mx1	T	C	16: 97,255,405 (GRCm39)	D216G	probably damaging	Het
Panx3	A	G	9: 37,580,177 (GRCm39)	S59P	possibly damaging	Het
Pcdhgb1	A	G	18: 37,814,907 (GRCm39)	D466G	probably damaging	Het
Plg	T	C	17: 12,597,605 (GRCm39)		probably null	Het
Prpf4b	T	C	13: 35,070,693 (GRCm39)	S427P	probably benign	Het
Rbm44	T	C	1: 91,080,411 (GRCm39)	S166P	possibly damaging	Het
Recql	A	G	6: 142,318,604 (GRCm39)	L213P	probably damaging	Het
Rwdd1	A	G	10: 33,885,081 (GRCm39)	Y60H	probably damaging	Het
Sult1b1	A	C	5: 87,682,816 (GRCm39)	I43R	probably damaging	Het
Trak2	A	T	1: 58,947,849 (GRCm39)	V597E	probably benign	Het
Usp17lb	T	A	7: 104,490,394 (GRCm39)	I177F	probably damaging	Het
Zfp410	A	G	12: 84,378,414 (GRCm39)	E193G	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	96,452,707 (GRCm39)	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	96,487,165 (GRCm39)	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	96,467,637 (GRCm39)	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	96,455,346 (GRCm39)	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	96,482,761 (GRCm39)	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	96,500,113 (GRCm39)	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	96,471,645 (GRCm39)	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	96,481,706 (GRCm39)	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	96,496,243 (GRCm39)	intron	probably benign
IGL03174:Cnot1	APN	8	96,487,983 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	96,462,308 (GRCm39)	splice site	probably benign
IGL03371:Cnot1	APN	8	96,501,344 (GRCm39)	missense	possibly damaging	0.85
Affiliate	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
Barge	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
Byproduct	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
Chairman	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
cohort	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
Director	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
kowloon	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
Quorum	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
tugboat	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
Xiao	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB003:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB011:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB013:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	96,489,772 (GRCm39)	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	96,498,628 (GRCm39)	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	96,475,483 (GRCm39)	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	96,486,836 (GRCm39)	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	96,455,295 (GRCm39)	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	96,469,841 (GRCm39)	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	96,496,460 (GRCm39)	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	96,474,904 (GRCm39)	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	96,451,205 (GRCm39)	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	96,468,572 (GRCm39)	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	96,451,221 (GRCm39)	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	96,466,469 (GRCm39)	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	96,501,986 (GRCm39)	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	96,452,781 (GRCm39)	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	96,488,054 (GRCm39)	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	96,475,690 (GRCm39)	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	96,501,280 (GRCm39)	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	96,466,476 (GRCm39)	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	96,496,407 (GRCm39)	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	96,501,310 (GRCm39)	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	96,459,859 (GRCm39)	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	96,489,695 (GRCm39)	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	96,448,254 (GRCm39)	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	96,467,636 (GRCm39)	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	96,479,396 (GRCm39)	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	96,486,815 (GRCm39)	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	96,483,983 (GRCm39)	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	96,470,924 (GRCm39)	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	96,460,775 (GRCm39)	nonsense	probably null
R5956:Cnot1	UTSW	8	96,481,606 (GRCm39)	critical splice donor site	probably null
R6093:Cnot1	UTSW	8	96,475,522 (GRCm39)	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	96,468,549 (GRCm39)	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	96,499,895 (GRCm39)	intron	probably benign
R6882:Cnot1	UTSW	8	96,447,054 (GRCm39)	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	96,451,160 (GRCm39)	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	96,459,787 (GRCm39)	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	96,454,276 (GRCm39)	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	96,478,447 (GRCm39)	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	96,497,260 (GRCm39)	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	96,486,726 (GRCm39)	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	96,478,406 (GRCm39)	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7914:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7924:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7926:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7981:Cnot1	UTSW	8	96,489,797 (GRCm39)	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	96,479,380 (GRCm39)	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	96,487,979 (GRCm39)	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	96,478,389 (GRCm39)	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	96,473,649 (GRCm39)	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	96,496,472 (GRCm39)	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	96,460,952 (GRCm39)	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	96,462,907 (GRCm39)	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	96,491,695 (GRCm39)	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	96,475,660 (GRCm39)	missense	probably benign
R9179:Cnot1	UTSW	8	96,500,054 (GRCm39)	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	96,497,227 (GRCm39)	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	96,497,338 (GRCm39)	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	96,482,854 (GRCm39)	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	96,482,835 (GRCm39)	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	96,455,874 (GRCm39)	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	96,488,019 (GRCm39)	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	96,496,209 (GRCm39)	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	96,455,772 (GRCm39)	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	96,469,726 (GRCm39)	splice site	probably null
Z1176:Cnot1	UTSW	8	96,474,905 (GRCm39)	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TGTGAACGTACCCATAGACTG -3'
(R):5'- TTCAGAACAGAGTAAGACACTTGG -3'

Sequencing Primer
(F):5'- CGTACCCATAGACTGATATAAGGTC -3'
(R):5'- GACATTTACAGATAACAGAGATAGCC -3'

Posted On

2017-06-26