Incidental Mutation 'R8306:Cnot1'
ID 641075
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 067792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95747021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1153 (N1153K)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: N1153K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: N1153K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: N1158K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: N1158K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: N1151K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
AA Change: N625K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: N1158K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
Quorum UTSW 8 95726118 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9179:Cnot1 UTSW 8 95773426 missense probably benign 0.16
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9480:Cnot1 UTSW 8 95770710 missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 95756226 missense probably benign 0.02
R9601:Cnot1 UTSW 8 95756207 missense probably benign 0.02
R9629:Cnot1 UTSW 8 95729246 missense probably damaging 0.98
R9752:Cnot1 UTSW 8 95761391 missense probably damaging 1.00
R9764:Cnot1 UTSW 8 95769581 missense probably benign 0.00
R9789:Cnot1 UTSW 8 95729144 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AAACCTATGGCACTCTCCATG -3'
(R):5'- TGTGATTCAGAGAACCTGGAC -3'

Sequencing Primer
(F):5'- TATGGCACTCTCCATGGACAC -3'
(R):5'- GAGAACCTGGACTTCATTTTATCTG -3'
Posted On 2020-07-28