Mutagenetix > Incidental Mutations

Incidental Mutation 'R8306:Cnot1'

641075

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8306 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95747021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1153 (N1153K)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: N1153K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: N1153K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: N1158K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: N1158K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: N1151K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000211973
AA Change: N625K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: N1158K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	C	A	11: 101,411,368	V158F	probably damaging	Het
Adam1b	T	C	5: 121,503,149		probably benign	Het
Ambn	G	A	5: 88,459,422	E50K	possibly damaging	Het
Ash1l	A	G	3: 88,965,952	D14G	probably benign	Het
Asphd1	C	T	7: 126,948,612	R173H	probably damaging	Het
Atr	A	T	9: 95,920,370	T1772S		Het
Best3	T	C	10: 117,002,610	L191P	probably damaging	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Borcs6	T	C	11: 69,059,820	L8P	probably benign	Het
Brca1	T	G	11: 101,525,637	Q557P	probably damaging	Het
Brca2	G	A	5: 150,536,663	E468K	possibly damaging	Het
Btbd11	T	A	10: 85,598,545	C22*	probably null	Het
Capza2	T	A	6: 17,637,132	L4Q	probably benign	Het
Cc2d2b	T	A	19: 40,815,784	Y918*	probably null	Het
Ccdc163	T	C	4: 116,710,275	L67P	probably damaging	Het
Ccdc172	C	A	19: 58,536,590	Q160K	probably damaging	Het
Ccp110	T	A	7: 118,722,680	D519E	probably benign	Het
Cd300ld2	T	C	11: 115,013,822	Q73R	probably benign	Het
Cfap46	T	A	7: 139,656,580	D608V		Het
Cfap69	T	G	5: 5,604,287	Y549S	probably benign	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Clu	A	C	14: 65,979,762	Q348P	probably damaging	Het
Col2a1	T	C	15: 97,990,968		probably null	Het
Col6a6	A	T	9: 105,784,073	I279N	probably damaging	Het
Dopey1	A	G	9: 86,520,206	D1153G	possibly damaging	Het
Dpyd	A	G	3: 119,412,173	K888E	probably benign	Het
Eif2ak4	T	C	2: 118,457,175	I1208T	possibly damaging	Het
Epha1	T	C	6: 42,358,788	I972V	probably damaging	Het
Fam13c	C	T	10: 70,553,153	T503I	probably benign	Het
Fbxo43	T	A	15: 36,161,867	Q398L	probably benign	Het
Fbxo44	A	G	4: 148,158,632	I57T	probably benign	Het
Flnc	T	C	6: 29,449,370	I1422T	probably benign	Het
Flrt2	T	C	12: 95,779,302	L138P	probably damaging	Het
Frem3	A	G	8: 80,612,211	K378E	possibly damaging	Het
Ganc	T	A	2: 120,422,079	D128E	probably benign	Het
Gm19965	T	C	1: 116,821,785	S399P		Het
H2-Q1	A	T	17: 35,321,021	K89*	probably null	Het
H2-Q2	A	T	17: 35,342,325		probably benign	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Homer2	T	A	7: 81,624,266	S125C	possibly damaging	Het
Hormad2	T	C	11: 4,408,714	K231R	probably benign	Het
Kif17	A	C	4: 138,277,909	K262Q	probably damaging	Het
Kif20a	G	A	18: 34,628,391	S279N	probably benign	Het
Lrp12	T	C	15: 39,878,054	N441D	probably damaging	Het
Lta4h	G	T	10: 93,482,264	L515F	possibly damaging	Het
Mavs	T	C	2: 131,246,550	S425P	probably benign	Het
Mcat	A	C	15: 83,555,391	D99E	probably damaging	Het
Nav2	C	A	7: 49,546,017	T1047K	probably benign	Het
Neb	T	A	2: 52,209,645	Y4731F	probably damaging	Het
Nectin4	G	C	1: 171,383,757	R283P	probably null	Het
Notch3	G	A	17: 32,158,112	T273I	probably damaging	Het
Olfr1205	G	A	2: 88,831,289	M57I	possibly damaging	Het
Olfr1415	T	G	1: 92,491,525	I77L	possibly damaging	Het
Olfr152	A	T	2: 87,783,486	*317C	probably null	Het
Olfr5	T	A	7: 6,480,869	I96F	possibly damaging	Het
Pcdha12	A	T	18: 37,022,585	T786S	probably benign	Het
Pde9a	A	G	17: 31,473,212	K520E	probably benign	Het
Piezo2	A	C	18: 63,075,730	L1404R	probably damaging	Het
Rrbp1	T	C	2: 143,950,496	S1321G	probably benign	Het
Rtkn	T	C	6: 83,151,916	V464A	probably damaging	Het
Rtn4rl1	T	C	11: 75,265,321	F193S	probably damaging	Het
Samd4	G	A	14: 46,884,917	V33I	probably damaging	Het
Scn5a	A	G	9: 119,521,291	L839P	probably damaging	Het
Slc6a17	C	A	3: 107,473,669	V507L	probably benign	Het
Stradb	C	A	1: 58,991,197	N203K	unknown	Het
Tenm2	T	C	11: 36,069,369	T1044A	possibly damaging	Het
Tmem245	A	C	4: 56,886,037	W860G	probably damaging	Het
Tpst2	G	A	5: 112,307,937	R114H	probably damaging	Het
Trappc10	C	T	10: 78,200,626	D920N	possibly damaging	Het
Vmn1r59	T	A	7: 5,453,967	I265L	probably benign	Het
Zbtb20	A	C	16: 43,618,737	D667A	probably damaging	Het
Zbtb4	T	A	11: 69,777,483	I344N	probably damaging	Het
Zdbf2	T	A	1: 63,304,075	C538S	possibly damaging	Het
Zmym6	A	T	4: 127,122,562	H712L	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AAACCTATGGCACTCTCCATG -3'
(R):5'- TGTGATTCAGAGAACCTGGAC -3'

Sequencing Primer
(F):5'- TATGGCACTCTCCATGGACAC -3'
(R):5'- GAGAACCTGGACTTCATTTTATCTG -3'

Posted On

2020-07-28