Mutagenetix > Incidental Mutations

Incidental Mutation 'R7695:Cnot1'

593610

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7695 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95770632 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 239 (I239N)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I239N

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I239N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I239N

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I239N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: I237N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000212323

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: I239N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	C	13: 98,984,258	T87A	probably damaging	Het
Adgrb1	T	C	15: 74,543,638	V689A	possibly damaging	Het
Casp12	A	G	9: 5,353,641	E225G	probably damaging	Het
Ccdc39	A	G	3: 33,814,519	L806P	probably damaging	Het
Ccnd3	T	A	17: 47,597,496	I164N	probably damaging	Het
Cd209b	A	G	8: 3,926,005	V52A	probably benign	Het
Celsr2	G	A	3: 108,402,753	R1554W	probably damaging	Het
Csmd3	A	T	15: 47,820,381	V948D		Het
Dnmt1	C	A	9: 20,913,985	G1061V	probably null	Het
Dpysl4	A	G	7: 139,086,123	M1V	probably null	Het
Elp5	T	C	11: 69,969,501	T227A	probably benign	Het
Exosc1	G	A	19: 41,928,080	H86Y	possibly damaging	Het
Foxn4	G	T	5: 114,256,587	D426E	probably damaging	Het
Gabbr2	A	G	4: 46,875,687	L145P	probably damaging	Het
Gkn3	A	G	6: 87,384,440	Y126H	probably damaging	Het
Gm16506	A	G	14: 43,725,006	F148S		Het
Gm3558	A	G	14: 7,551,798	I76T	probably benign	Het
Gm49359	A	G	13: 62,456,744	F45S	possibly damaging	Het
Gpc5	A	T	14: 115,092,594	H63L	unknown	Het
Hbs1l	A	T	10: 21,299,217	D28V	possibly damaging	Het
Ide	G	A	19: 37,329,036	H113Y		Het
Igkv3-3	A	T	6: 70,687,311	S46C	probably damaging	Het
Igsf10	A	T	3: 59,326,191	V1707D	probably damaging	Het
Kcna5	A	T	6: 126,534,211	V318E	probably damaging	Het
Kdm3b	T	C	18: 34,794,559	F158S	possibly damaging	Het
Lrrc14b	T	A	13: 74,363,178	D261V	possibly damaging	Het
Lrrc71	T	A	3: 87,739,462	I485F	probably damaging	Het
Map6	C	T	7: 99,336,292	L671F	possibly damaging	Het
Mast1	A	G	8: 84,920,928	V560A	probably damaging	Het
Mfap4	A	T	11: 61,485,719		probably null	Het
Myh9	A	G	15: 77,766,736	I1637T	probably benign	Het
Neo1	A	T	9: 58,902,929	F1080I	possibly damaging	Het
Olfr1269	A	G	2: 90,118,863	V245A	probably benign	Het
Olfr1298	A	G	2: 111,645,625	V124A	probably damaging	Het
Olfr23	T	A	11: 73,940,894	V216E	possibly damaging	Het
Olfr559	T	C	7: 102,723,659	H277R	probably benign	Het
Pax2	A	G	19: 44,833,199	Y318C	probably damaging	Het
Pcnx4	A	T	12: 72,541,576	M53L	probably benign	Het
Pkd2l2	T	A	18: 34,428,245	D435E	possibly damaging	Het
Plec	G	A	15: 76,183,855	Q1117*	probably null	Het
Ppp2r2c	T	C	5: 36,947,182	L302P	probably damaging	Het
Prex2	T	C	1: 11,162,273	F855L	probably benign	Het
Reg3d	A	T	6: 78,377,136	W103R	probably benign	Het
Rnf216	A	C	5: 143,085,904	H440Q	possibly damaging	Het
Scn2a	A	G	2: 65,711,907	T785A	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,831	Y844F	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Spp1	T	C	5: 104,435,143		probably benign	Het
Tacc2	T	A	7: 130,728,903	S196T	probably benign	Het
Thrap3	G	A	4: 126,180,098	S285L	probably damaging	Het
Ttn	T	A	2: 76,835,961	R11584*	probably null	Het
Ubap2	A	G	4: 41,211,740	S341P	probably damaging	Het
Upf3a	T	G	8: 13,798,279	S358R	probably benign	Het
Zdbf2	T	A	1: 63,307,370	I1636N	possibly damaging	Het
Zfp946	C	A	17: 22,455,021	T252N	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	not run
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CTTGAAAACCCTTGAAAATGTACCC -3'
(R):5'- CCAAGGCCTCGGGTATCATATG -3'

Sequencing Primer
(F):5'- TGAAAATGTACCCATCCTTTTCATG -3'
(R):5'- CCTCGGGTATCATATGGAGTATG -3'

Posted On

2019-11-12