Incidental Mutation 'R1996:Grin2b'
ID225741
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136044211 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 31 (S31G)
Ref Sequence ENSEMBL: ENSMUSP00000140452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: S31G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: S31G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: S31G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: S31G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125905
AA Change: S31G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000143943
AA Change: S31G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000152012
AA Change: S31G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: S31G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188999
AA Change: S31G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTCAGACATAAGATCGCAG -3'
(R):5'- CGAGTTTCATGAACCGCAG -3'

Sequencing Primer
(F):5'- CAGATGCGGGTGATTATGCTC -3'
(R):5'- CATTCAGACACTTCAAGGATGCGTTC -3'
Posted On2014-08-25